Incidental Mutation 'R1590:Samd9l'
ID 177800
Institutional Source Beutler Lab
Gene Symbol Samd9l
Ensembl Gene ENSMUSG00000047735
Gene Name sterile alpha motif domain containing 9-like
Synonyms ESTM25
MMRRC Submission 039627-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1590 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 3372257-3399571 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 3375761 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 500 (C500F)
Ref Sequence ENSEMBL: ENSMUSP00000112688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120087] [ENSMUST00000201638]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000120087
AA Change: C500F

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000112688
Gene: ENSMUSG00000047735
AA Change: C500F

DomainStartEndE-ValueType
SCOP:d1kw4a_ 8 75 4e-8 SMART
Blast:SAM 11 75 1e-30 BLAST
low complexity region 96 115 N/A INTRINSIC
low complexity region 385 397 N/A INTRINSIC
low complexity region 530 541 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201638
SMART Domains Protein: ENSMUSP00000144632
Gene: ENSMUSG00000047735

DomainStartEndE-ValueType
Pfam:Ste50p-SAM 10 80 1.2e-8 PFAM
Pfam:SAM_2 11 68 8.7e-6 PFAM
Pfam:SAM_1 12 71 2.5e-7 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.4%
Validation Efficiency 97% (69/71)
MGI Phenotype PHENOTYPE: Mice that are either heterozygous or homozygous for a reporter allele develop myeloid diseases and acute myelogenous leukemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,322,370 (GRCm39) S95P probably damaging Het
Ankmy1 T C 1: 92,816,397 (GRCm39) Y239C probably damaging Het
Atp12a T C 14: 56,617,512 (GRCm39) S601P probably damaging Het
Atp1b3 T C 9: 96,225,402 (GRCm39) T89A probably benign Het
B3galt4 G A 17: 34,169,813 (GRCm39) R142C probably damaging Het
Brme1 A T 8: 84,893,715 (GRCm39) Q294L probably benign Het
Btnl2 A T 17: 34,580,114 (GRCm39) I216F possibly damaging Het
Cabs1 A T 5: 88,127,490 (GRCm39) H47L probably damaging Het
Ccdc68 T A 18: 70,073,251 (GRCm39) D66E probably benign Het
Cdc42ep4 T C 11: 113,619,392 (GRCm39) D333G possibly damaging Het
Ckmt1 G A 2: 121,194,003 (GRCm39) D389N possibly damaging Het
Dact1 G T 12: 71,364,349 (GRCm39) V340F probably benign Het
Dnah2 T C 11: 69,412,024 (GRCm39) T246A probably benign Het
Dnah2 A G 11: 69,313,580 (GRCm39) probably null Het
Ecm1 G A 3: 95,643,275 (GRCm39) R342C probably damaging Het
Efcab14 A G 4: 115,613,746 (GRCm39) probably benign Het
Eprs1 A G 1: 185,133,707 (GRCm39) T795A probably damaging Het
Esp36 T A 17: 38,728,202 (GRCm39) E26D possibly damaging Het
Fpr-rs7 T C 17: 20,333,678 (GRCm39) T271A probably benign Het
Fsip2 A T 2: 82,813,131 (GRCm39) H3150L probably benign Het
Gimap7 G A 6: 48,700,953 (GRCm39) V180M probably damaging Het
Gtf3c1 T C 7: 125,275,833 (GRCm39) H531R possibly damaging Het
Herc1 T A 9: 66,399,235 (GRCm39) probably benign Het
Hip1r A G 5: 124,140,203 (GRCm39) Y1061C probably benign Het
Ipo11 T C 13: 107,023,225 (GRCm39) Y420C probably damaging Het
Ipo8 T C 6: 148,712,163 (GRCm39) probably null Het
Itga10 C T 3: 96,559,054 (GRCm39) probably benign Het
Klhl1 A T 14: 96,606,072 (GRCm39) M243K probably damaging Het
Lrp2 A G 2: 69,297,107 (GRCm39) probably null Het
Mag T C 7: 30,601,277 (GRCm39) E439G probably damaging Het
Mcm3ap T A 10: 76,332,375 (GRCm39) F1231I probably benign Het
Mcmdc2 C T 1: 9,986,780 (GRCm39) Q204* probably null Het
Mpl A C 4: 118,301,221 (GRCm39) L548R probably damaging Het
Mrps2 C T 2: 28,359,500 (GRCm39) A119V probably benign Het
Myo18b G A 5: 113,023,132 (GRCm39) Q87* probably null Het
Nfat5 A G 8: 108,020,522 (GRCm39) Y22C probably damaging Het
Nnt T A 13: 119,523,197 (GRCm39) I232L possibly damaging Het
Or2a52 A G 6: 43,144,846 (GRCm39) N285D probably damaging Het
Or8g17 T C 9: 38,930,253 (GRCm39) N195D probably benign Het
Or9s13 G A 1: 92,548,467 (GRCm39) V280M possibly damaging Het
Parp2 C T 14: 51,048,001 (GRCm39) P76S probably benign Het
Pick1 C T 15: 79,129,501 (GRCm39) H169Y probably benign Het
Prtg T A 9: 72,750,089 (GRCm39) F164L probably benign Het
Pygb A G 2: 150,659,583 (GRCm39) D422G possibly damaging Het
Sbno1 A C 5: 124,522,567 (GRCm39) N1083K possibly damaging Het
Septin7 C T 9: 25,188,900 (GRCm39) S77F probably damaging Het
Slc25a44 A G 3: 88,323,314 (GRCm39) V264A possibly damaging Het
Slco1a8 C T 6: 141,926,598 (GRCm39) S576N probably benign Het
Slf2 G T 19: 44,930,512 (GRCm39) E530* probably null Het
Svs5 A G 2: 164,079,578 (GRCm39) S110P possibly damaging Het
Tmbim7 G T 5: 3,715,338 (GRCm39) probably null Het
Tpgs2 T C 18: 25,273,630 (GRCm39) D177G probably damaging Het
Uba1y T A Y: 826,893 (GRCm39) F516L probably damaging Het
Ulk1 A G 5: 110,943,632 (GRCm39) V211A probably damaging Het
Vmn1r237 T A 17: 21,534,301 (GRCm39) I8N probably damaging Het
Vmn2r103 G T 17: 20,014,496 (GRCm39) M429I probably benign Het
Vmn2r112 T C 17: 22,833,989 (GRCm39) probably null Het
Vmn2r84 T C 10: 130,227,349 (GRCm39) probably null Het
Vwa8 C T 14: 79,145,670 (GRCm39) R116C probably damaging Het
Other mutations in Samd9l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Samd9l APN 6 3,376,779 (GRCm39) missense probably damaging 0.96
IGL00550:Samd9l APN 6 3,374,594 (GRCm39) missense probably benign 0.00
IGL01100:Samd9l APN 6 3,375,863 (GRCm39) missense possibly damaging 0.91
IGL01321:Samd9l APN 6 3,376,259 (GRCm39) missense probably benign 0.42
IGL01553:Samd9l APN 6 3,375,566 (GRCm39) missense probably damaging 0.99
IGL01575:Samd9l APN 6 3,376,734 (GRCm39) missense possibly damaging 0.85
IGL01896:Samd9l APN 6 3,375,120 (GRCm39) missense probably benign 0.02
IGL01915:Samd9l APN 6 3,373,864 (GRCm39) nonsense probably null
IGL02063:Samd9l APN 6 3,372,992 (GRCm39) missense probably damaging 1.00
IGL02066:Samd9l APN 6 3,376,575 (GRCm39) missense probably damaging 1.00
IGL02145:Samd9l APN 6 3,374,105 (GRCm39) missense probably benign 0.13
IGL02163:Samd9l APN 6 3,374,246 (GRCm39) missense possibly damaging 0.90
IGL02256:Samd9l APN 6 3,376,197 (GRCm39) missense probably damaging 1.00
IGL02508:Samd9l APN 6 3,374,798 (GRCm39) missense probably damaging 1.00
IGL02591:Samd9l APN 6 3,375,760 (GRCm39) missense possibly damaging 0.91
IGL02968:Samd9l APN 6 3,376,026 (GRCm39) missense probably damaging 1.00
IGL03058:Samd9l APN 6 3,374,980 (GRCm39) missense probably damaging 0.99
IGL03068:Samd9l APN 6 3,375,348 (GRCm39) nonsense probably null
IGL03160:Samd9l APN 6 3,374,894 (GRCm39) missense probably damaging 1.00
IGL03372:Samd9l APN 6 3,375,314 (GRCm39) missense probably damaging 1.00
IGL03385:Samd9l APN 6 3,376,208 (GRCm39) missense probably damaging 0.99
boston_lager UTSW 6 3,375,761 (GRCm39) missense probably benign 0.12
ipa UTSW 6 3,376,347 (GRCm39) missense probably damaging 1.00
Paine UTSW 6 3,372,716 (GRCm39) missense probably damaging 0.99
samad UTSW 6 3,374,032 (GRCm39) nonsense probably null
IGL03054:Samd9l UTSW 6 3,376,023 (GRCm39) missense probably damaging 1.00
R0111:Samd9l UTSW 6 3,374,946 (GRCm39) missense possibly damaging 0.80
R0112:Samd9l UTSW 6 3,376,031 (GRCm39) missense possibly damaging 0.93
R0356:Samd9l UTSW 6 3,375,107 (GRCm39) missense possibly damaging 0.69
R0370:Samd9l UTSW 6 3,377,264 (GRCm39) start gained probably benign
R0398:Samd9l UTSW 6 3,374,502 (GRCm39) missense probably damaging 1.00
R0744:Samd9l UTSW 6 3,372,725 (GRCm39) missense possibly damaging 0.92
R0833:Samd9l UTSW 6 3,372,725 (GRCm39) missense possibly damaging 0.92
R0880:Samd9l UTSW 6 3,377,064 (GRCm39) missense probably damaging 0.99
R1110:Samd9l UTSW 6 3,374,267 (GRCm39) missense probably benign 0.44
R1155:Samd9l UTSW 6 3,376,939 (GRCm39) missense probably benign 0.01
R1268:Samd9l UTSW 6 3,376,113 (GRCm39) missense possibly damaging 0.56
R1293:Samd9l UTSW 6 3,373,947 (GRCm39) missense possibly damaging 0.93
R1478:Samd9l UTSW 6 3,376,369 (GRCm39) missense probably benign 0.06
R1573:Samd9l UTSW 6 3,375,426 (GRCm39) missense probably damaging 0.99
R1611:Samd9l UTSW 6 3,373,771 (GRCm39) missense probably benign 0.00
R1754:Samd9l UTSW 6 3,373,126 (GRCm39) missense probably damaging 0.96
R1759:Samd9l UTSW 6 3,373,401 (GRCm39) missense probably damaging 1.00
R1795:Samd9l UTSW 6 3,375,264 (GRCm39) nonsense probably null
R1829:Samd9l UTSW 6 3,375,107 (GRCm39) missense possibly damaging 0.69
R1935:Samd9l UTSW 6 3,376,269 (GRCm39) missense probably benign 0.01
R2154:Samd9l UTSW 6 3,372,945 (GRCm39) missense possibly damaging 0.91
R2228:Samd9l UTSW 6 3,376,910 (GRCm39) missense probably benign 0.08
R3622:Samd9l UTSW 6 3,374,032 (GRCm39) nonsense probably null
R3903:Samd9l UTSW 6 3,376,830 (GRCm39) nonsense probably null
R3904:Samd9l UTSW 6 3,376,830 (GRCm39) nonsense probably null
R3945:Samd9l UTSW 6 3,377,029 (GRCm39) missense possibly damaging 0.71
R4091:Samd9l UTSW 6 3,376,887 (GRCm39) missense probably benign 0.22
R4602:Samd9l UTSW 6 3,373,937 (GRCm39) frame shift probably null
R4602:Samd9l UTSW 6 3,373,935 (GRCm39) missense probably damaging 1.00
R4618:Samd9l UTSW 6 3,376,347 (GRCm39) missense probably damaging 1.00
R4747:Samd9l UTSW 6 3,375,504 (GRCm39) nonsense probably null
R4762:Samd9l UTSW 6 3,375,623 (GRCm39) missense probably benign 0.01
R4814:Samd9l UTSW 6 3,372,863 (GRCm39) missense probably damaging 0.98
R4934:Samd9l UTSW 6 3,375,621 (GRCm39) nonsense probably null
R5026:Samd9l UTSW 6 3,375,284 (GRCm39) missense possibly damaging 0.75
R5048:Samd9l UTSW 6 3,374,157 (GRCm39) missense probably benign 0.35
R5130:Samd9l UTSW 6 3,374,548 (GRCm39) missense possibly damaging 0.69
R5271:Samd9l UTSW 6 3,376,156 (GRCm39) missense probably benign 0.02
R5328:Samd9l UTSW 6 3,376,739 (GRCm39) missense probably damaging 0.99
R5507:Samd9l UTSW 6 3,373,898 (GRCm39) missense possibly damaging 0.78
R5587:Samd9l UTSW 6 3,373,291 (GRCm39) missense possibly damaging 0.84
R5846:Samd9l UTSW 6 3,376,754 (GRCm39) missense probably benign
R5881:Samd9l UTSW 6 3,372,716 (GRCm39) missense possibly damaging 0.70
R5889:Samd9l UTSW 6 3,376,460 (GRCm39) missense probably damaging 1.00
R6131:Samd9l UTSW 6 3,377,252 (GRCm39) missense probably benign 0.00
R6199:Samd9l UTSW 6 3,376,686 (GRCm39) missense probably benign 0.13
R6298:Samd9l UTSW 6 3,375,383 (GRCm39) missense probably damaging 1.00
R6331:Samd9l UTSW 6 3,376,361 (GRCm39) missense probably damaging 1.00
R6489:Samd9l UTSW 6 3,376,896 (GRCm39) missense probably benign
R6601:Samd9l UTSW 6 3,377,229 (GRCm39) missense possibly damaging 0.74
R6655:Samd9l UTSW 6 3,377,247 (GRCm39) missense probably benign 0.22
R6803:Samd9l UTSW 6 3,375,446 (GRCm39) missense probably damaging 0.97
R6864:Samd9l UTSW 6 3,374,750 (GRCm39) missense probably benign 0.14
R6905:Samd9l UTSW 6 3,375,387 (GRCm39) missense probably damaging 0.99
R6919:Samd9l UTSW 6 3,376,313 (GRCm39) missense possibly damaging 0.88
R7060:Samd9l UTSW 6 3,372,716 (GRCm39) missense probably damaging 0.99
R7073:Samd9l UTSW 6 3,375,856 (GRCm39) nonsense probably null
R7250:Samd9l UTSW 6 3,374,201 (GRCm39) missense possibly damaging 0.78
R7307:Samd9l UTSW 6 3,372,600 (GRCm39) nonsense probably null
R7351:Samd9l UTSW 6 3,374,157 (GRCm39) missense probably benign 0.35
R7423:Samd9l UTSW 6 3,374,408 (GRCm39) missense probably damaging 1.00
R7610:Samd9l UTSW 6 3,376,754 (GRCm39) missense probably benign
R7667:Samd9l UTSW 6 3,375,975 (GRCm39) missense possibly damaging 0.87
R7672:Samd9l UTSW 6 3,373,646 (GRCm39) missense probably benign 0.16
R7680:Samd9l UTSW 6 3,376,469 (GRCm39) missense probably damaging 1.00
R7680:Samd9l UTSW 6 3,372,569 (GRCm39) missense probably damaging 1.00
R7814:Samd9l UTSW 6 3,374,793 (GRCm39) missense possibly damaging 0.86
R7829:Samd9l UTSW 6 3,374,749 (GRCm39) missense probably benign 0.00
R8000:Samd9l UTSW 6 3,373,034 (GRCm39) missense probably damaging 1.00
R8098:Samd9l UTSW 6 3,375,549 (GRCm39) missense probably damaging 1.00
R8698:Samd9l UTSW 6 3,373,843 (GRCm39) missense probably benign 0.06
R8785:Samd9l UTSW 6 3,377,064 (GRCm39) missense probably damaging 0.99
R8795:Samd9l UTSW 6 3,374,221 (GRCm39) nonsense probably null
R8806:Samd9l UTSW 6 3,376,665 (GRCm39) missense probably damaging 0.99
R8832:Samd9l UTSW 6 3,374,990 (GRCm39) missense probably damaging 1.00
R8954:Samd9l UTSW 6 3,374,577 (GRCm39) missense probably damaging 0.98
R9023:Samd9l UTSW 6 3,373,791 (GRCm39) missense probably damaging 1.00
R9051:Samd9l UTSW 6 3,373,493 (GRCm39) missense probably benign 0.16
R9108:Samd9l UTSW 6 3,373,104 (GRCm39) missense possibly damaging 0.71
R9213:Samd9l UTSW 6 3,376,856 (GRCm39) missense probably benign 0.23
R9494:Samd9l UTSW 6 3,375,830 (GRCm39) missense possibly damaging 0.51
R9504:Samd9l UTSW 6 3,372,621 (GRCm39) missense probably benign 0.17
R9655:Samd9l UTSW 6 3,373,578 (GRCm39) missense probably benign 0.00
R9688:Samd9l UTSW 6 3,377,087 (GRCm39) missense probably damaging 1.00
R9696:Samd9l UTSW 6 3,375,078 (GRCm39) missense possibly damaging 0.76
R9721:Samd9l UTSW 6 3,375,854 (GRCm39) missense possibly damaging 0.69
X0026:Samd9l UTSW 6 3,375,560 (GRCm39) missense probably damaging 1.00
X0066:Samd9l UTSW 6 3,374,477 (GRCm39) missense probably damaging 1.00
Z1176:Samd9l UTSW 6 3,376,770 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCAGAATAACAGAGGAGGAGCC -3'
(R):5'- TCACATCAAGGGAGTGGTCAAAGC -3'

Sequencing Primer
(F):5'- GATCACTCCATTGTTGGTAGATAGC -3'
(R):5'- GGGAGTGGTCAAAGCTTACAG -3'
Posted On 2014-04-24