Incidental Mutation 'R1590:Dact1'
ID177819
Institutional Source Beutler Lab
Gene Symbol Dact1
Ensembl Gene ENSMUSG00000044548
Gene Namedishevelled-binding antagonist of beta-catenin 1
SynonymsFrodo, Dapper1, Frodo1, THYEX3, Frd1
MMRRC Submission 039627-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1590 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location71309884-71320107 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 71317575 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 340 (V340F)
Ref Sequence ENSEMBL: ENSMUSP00000058943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061273] [ENSMUST00000150639]
Predicted Effect probably benign
Transcript: ENSMUST00000061273
AA Change: V340F

PolyPhen 2 Score 0.340 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000058943
Gene: ENSMUSG00000044548
AA Change: V340F

DomainStartEndE-ValueType
Pfam:Dapper 39 206 4.1e-83 PFAM
Pfam:Dapper 204 778 7.8e-184 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132822
Predicted Effect probably benign
Transcript: ENSMUST00000150639
AA Change: V377F

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000117169
Gene: ENSMUSG00000044548
AA Change: V377F

DomainStartEndE-ValueType
Pfam:Dapper 39 815 1.4e-240 PFAM
Meta Mutation Damage Score 0.0798 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.4%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dapper family, characterized by the presence of PDZ-binding motif at the C-terminus. It interacts with, and positively regulates dishevelled-mediated signaling pathways during development. Depletion of this mRNA from xenopus embryos resulted in loss of notochord and head structures, and mice lacking this gene died shortly after birth from severe posterior malformations. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, abnormal embryogenesis, blind-ended colons, and abnormal renal/urinary system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik A T 8: 84,167,086 Q294L probably benign Het
Aamp A G 1: 74,283,211 S95P probably damaging Het
Ankmy1 T C 1: 92,888,675 Y239C probably damaging Het
Atp12a T C 14: 56,380,055 S601P probably damaging Het
Atp1b3 T C 9: 96,343,349 T89A probably benign Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
Btnl2 A T 17: 34,361,140 I216F possibly damaging Het
Cabs1 A T 5: 87,979,631 H47L probably damaging Het
Ccdc68 T A 18: 69,940,180 D66E probably benign Het
Cdc42ep4 T C 11: 113,728,566 D333G possibly damaging Het
Ckmt1 G A 2: 121,363,522 D389N possibly damaging Het
Dnah2 A G 11: 69,422,754 probably null Het
Dnah2 T C 11: 69,521,198 T246A probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Efcab14 A G 4: 115,756,549 probably benign Het
Eprs A G 1: 185,401,510 T795A probably damaging Het
Esp36 T A 17: 38,417,311 E26D possibly damaging Het
Fpr-rs7 T C 17: 20,113,416 T271A probably benign Het
Fsip2 A T 2: 82,982,787 H3150L probably benign Het
Gimap7 G A 6: 48,724,019 V180M probably damaging Het
Gm6614 C T 6: 141,980,872 S576N probably benign Het
Gtf3c1 T C 7: 125,676,661 H531R possibly damaging Het
Herc1 T A 9: 66,491,953 probably benign Het
Hip1r A G 5: 124,002,140 Y1061C probably benign Het
Ipo11 T C 13: 106,886,717 Y420C probably damaging Het
Ipo8 T C 6: 148,810,665 probably null Het
Itga10 C T 3: 96,651,738 probably benign Het
Klhl1 A T 14: 96,368,636 M243K probably damaging Het
Lrp2 A G 2: 69,466,763 probably null Het
Mag T C 7: 30,901,852 E439G probably damaging Het
Mcm3ap T A 10: 76,496,541 F1231I probably benign Het
Mcmdc2 C T 1: 9,916,555 Q204* probably null Het
Mpl A C 4: 118,444,024 L548R probably damaging Het
Mrps2 C T 2: 28,469,488 A119V probably benign Het
Myo18b G A 5: 112,875,266 Q87* probably null Het
Nfat5 A G 8: 107,293,890 Y22C probably damaging Het
Nnt T A 13: 119,386,661 I232L possibly damaging Het
Olfr12 G A 1: 92,620,745 V280M possibly damaging Het
Olfr146 T C 9: 39,018,957 N195D probably benign Het
Olfr437 A G 6: 43,167,912 N285D probably damaging Het
Parp2 C T 14: 50,810,544 P76S probably benign Het
Pick1 C T 15: 79,245,301 H169Y probably benign Het
Prtg T A 9: 72,842,807 F164L probably benign Het
Pygb A G 2: 150,817,663 D422G possibly damaging Het
Samd9l C A 6: 3,375,761 C500F probably benign Het
Sbno1 A C 5: 124,384,504 N1083K possibly damaging Het
Sept7 C T 9: 25,277,604 S77F probably damaging Het
Slc25a44 A G 3: 88,416,007 V264A possibly damaging Het
Slf2 G T 19: 44,942,073 E530* probably null Het
Svs2 A G 2: 164,237,658 S110P possibly damaging Het
Tmbim7 G T 5: 3,665,338 probably null Het
Tpgs2 T C 18: 25,140,573 D177G probably damaging Het
Uba1y T A Y: 826,893 F516L probably damaging Het
Ulk1 A G 5: 110,795,766 V211A probably damaging Het
Vmn1r237 T A 17: 21,314,039 I8N probably damaging Het
Vmn2r103 G T 17: 19,794,234 M429I probably benign Het
Vmn2r112 T C 17: 22,615,008 probably null Het
Vmn2r84 T C 10: 130,391,480 probably null Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Other mutations in Dact1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03268:Dact1 APN 12 71317483 missense probably damaging 1.00
R0930:Dact1 UTSW 12 71318460 missense probably damaging 1.00
R1669:Dact1 UTSW 12 71318773 missense probably damaging 1.00
R1694:Dact1 UTSW 12 71312777 missense probably damaging 1.00
R1826:Dact1 UTSW 12 71318344 missense probably damaging 1.00
R4398:Dact1 UTSW 12 71317185 missense probably damaging 1.00
R5028:Dact1 UTSW 12 71318573 nonsense probably null
R5917:Dact1 UTSW 12 71318682 missense possibly damaging 0.75
R6432:Dact1 UTSW 12 71318553 missense probably damaging 1.00
R6473:Dact1 UTSW 12 71317698 missense probably benign 0.00
R6759:Dact1 UTSW 12 71318137 nonsense probably null
R6823:Dact1 UTSW 12 71317939 missense probably benign 0.10
R7564:Dact1 UTSW 12 71318551 missense probably damaging 1.00
R7776:Dact1 UTSW 12 71317914 missense probably benign
X0025:Dact1 UTSW 12 71317852 missense probably damaging 1.00
Z1177:Dact1 UTSW 12 71310051 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- AAGCAGTTTGTGGTCCGCTTCC -3'
(R):5'- TGAGCCCTCGCTTTTGAAGTCC -3'

Sequencing Primer
(F):5'- TCCCATCCTGCATCCAGTAAG -3'
(R):5'- CTTTTGAAGTCCAAGGCCG -3'
Posted On2014-04-24