Incidental Mutation 'R1590:Parp2'
ID177822
Institutional Source Beutler Lab
Gene Symbol Parp2
Ensembl Gene ENSMUSG00000036023
Gene Namepoly (ADP-ribose) polymerase family, member 2
SynonymsPARP-2, Adprtl2, C78626, Aspartl2, Adprt2
MMRRC Submission 039627-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock #R1590 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location50807841-50821301 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 50810544 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 76 (P76S)
Ref Sequence ENSEMBL: ENSMUSP00000048877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036126] [ENSMUST00000227614] [ENSMUST00000227810]
PDB Structure
CRYSTAL STRUCTURE OF THE CATALYTIC FRAGMENT OF MURINE POLY (ADP-RIBOSE) POLYMERASE-2 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000036126
AA Change: P76S

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000048877
Gene: ENSMUSG00000036023
AA Change: P76S

DomainStartEndE-ValueType
WGR 95 175 1.17e-35 SMART
Pfam:PARP_reg 208 338 1.4e-49 PFAM
Pfam:PARP 341 553 1.8e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175096
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226880
Predicted Effect probably benign
Transcript: ENSMUST00000227614
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227705
Predicted Effect probably benign
Transcript: ENSMUST00000227810
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228672
Meta Mutation Damage Score 0.1054 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.4%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes poly(ADP-ribosyl)transferase-like 2 protein, which contains a catalytic domain and is capable of catalyzing a poly(ADP-ribosyl)ation reaction. This protein has a catalytic domain which is homologous to that of poly (ADP-ribosyl) transferase, but lacks an N-terminal DNA binding domain which activates the C-terminal catalytic domain of poly (ADP-ribosyl) transferase. The basic residues within the N-terminal region of this protein may bear potential DNA-binding properties, and may be involved in the nuclear and/or nucleolar targeting of the protein. Two alternatively spliced transcript variants encoding distinct isoforms have been found. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant animals are sensitive to gamma radiation. Epithelial crypt degeneration and DNA repair deficiency is apparent following radiation-induced injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik A T 8: 84,167,086 Q294L probably benign Het
Aamp A G 1: 74,283,211 S95P probably damaging Het
Ankmy1 T C 1: 92,888,675 Y239C probably damaging Het
Atp12a T C 14: 56,380,055 S601P probably damaging Het
Atp1b3 T C 9: 96,343,349 T89A probably benign Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
Btnl2 A T 17: 34,361,140 I216F possibly damaging Het
Cabs1 A T 5: 87,979,631 H47L probably damaging Het
Ccdc68 T A 18: 69,940,180 D66E probably benign Het
Cdc42ep4 T C 11: 113,728,566 D333G possibly damaging Het
Ckmt1 G A 2: 121,363,522 D389N possibly damaging Het
Dact1 G T 12: 71,317,575 V340F probably benign Het
Dnah2 A G 11: 69,422,754 probably null Het
Dnah2 T C 11: 69,521,198 T246A probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Efcab14 A G 4: 115,756,549 probably benign Het
Eprs A G 1: 185,401,510 T795A probably damaging Het
Esp36 T A 17: 38,417,311 E26D possibly damaging Het
Fpr-rs7 T C 17: 20,113,416 T271A probably benign Het
Fsip2 A T 2: 82,982,787 H3150L probably benign Het
Gimap7 G A 6: 48,724,019 V180M probably damaging Het
Gm6614 C T 6: 141,980,872 S576N probably benign Het
Gtf3c1 T C 7: 125,676,661 H531R possibly damaging Het
Herc1 T A 9: 66,491,953 probably benign Het
Hip1r A G 5: 124,002,140 Y1061C probably benign Het
Ipo11 T C 13: 106,886,717 Y420C probably damaging Het
Ipo8 T C 6: 148,810,665 probably null Het
Itga10 C T 3: 96,651,738 probably benign Het
Klhl1 A T 14: 96,368,636 M243K probably damaging Het
Lrp2 A G 2: 69,466,763 probably null Het
Mag T C 7: 30,901,852 E439G probably damaging Het
Mcm3ap T A 10: 76,496,541 F1231I probably benign Het
Mcmdc2 C T 1: 9,916,555 Q204* probably null Het
Mpl A C 4: 118,444,024 L548R probably damaging Het
Mrps2 C T 2: 28,469,488 A119V probably benign Het
Myo18b G A 5: 112,875,266 Q87* probably null Het
Nfat5 A G 8: 107,293,890 Y22C probably damaging Het
Nnt T A 13: 119,386,661 I232L possibly damaging Het
Olfr12 G A 1: 92,620,745 V280M possibly damaging Het
Olfr146 T C 9: 39,018,957 N195D probably benign Het
Olfr437 A G 6: 43,167,912 N285D probably damaging Het
Pick1 C T 15: 79,245,301 H169Y probably benign Het
Prtg T A 9: 72,842,807 F164L probably benign Het
Pygb A G 2: 150,817,663 D422G possibly damaging Het
Samd9l C A 6: 3,375,761 C500F probably benign Het
Sbno1 A C 5: 124,384,504 N1083K possibly damaging Het
Sept7 C T 9: 25,277,604 S77F probably damaging Het
Slc25a44 A G 3: 88,416,007 V264A possibly damaging Het
Slf2 G T 19: 44,942,073 E530* probably null Het
Svs2 A G 2: 164,237,658 S110P possibly damaging Het
Tmbim7 G T 5: 3,665,338 probably null Het
Tpgs2 T C 18: 25,140,573 D177G probably damaging Het
Uba1y T A Y: 826,893 F516L probably damaging Het
Ulk1 A G 5: 110,795,766 V211A probably damaging Het
Vmn1r237 T A 17: 21,314,039 I8N probably damaging Het
Vmn2r103 G T 17: 19,794,234 M429I probably benign Het
Vmn2r112 T C 17: 22,615,008 probably null Het
Vmn2r84 T C 10: 130,391,480 probably null Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Other mutations in Parp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02826:Parp2 APN 14 50815415 missense probably benign 0.04
IGL03022:Parp2 APN 14 50821096 missense probably damaging 0.99
IGL03051:Parp2 APN 14 50819348 splice site probably benign
R0110:Parp2 UTSW 14 50819673 missense probably damaging 1.00
R0450:Parp2 UTSW 14 50819673 missense probably damaging 1.00
R0510:Parp2 UTSW 14 50819673 missense probably damaging 1.00
R1442:Parp2 UTSW 14 50819275 critical splice donor site probably null
R1668:Parp2 UTSW 14 50820856 missense probably benign 0.00
R1806:Parp2 UTSW 14 50819379 missense probably damaging 0.99
R1846:Parp2 UTSW 14 50815386 nonsense probably null
R2029:Parp2 UTSW 14 50810086 missense probably benign 0.14
R2990:Parp2 UTSW 14 50817000 missense probably benign
R3933:Parp2 UTSW 14 50819387 missense probably benign 0.44
R4921:Parp2 UTSW 14 50819268 missense probably damaging 0.99
R6406:Parp2 UTSW 14 50819477 missense probably benign
R6799:Parp2 UTSW 14 50821096 missense probably damaging 0.99
R7105:Parp2 UTSW 14 50810064 frame shift probably null
R7250:Parp2 UTSW 14 50817344 missense probably benign
R7606:Parp2 UTSW 14 50820030 missense probably damaging 1.00
RF002:Parp2 UTSW 14 50817386 missense probably damaging 1.00
X0019:Parp2 UTSW 14 50817099 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCTCCTCCTGGCAAGAAGATGC -3'
(R):5'- TTCTGCTAAGCTGAAACCTCATCACC -3'

Sequencing Primer
(F):5'- GACAACTCTTGGGTTTCCAGAAG -3'
(R):5'- TGAAACCTCATCACCCCTACTTC -3'
Posted On2014-04-24