Incidental Mutation 'R1590:Vmn2r103'
ID177828
Institutional Source Beutler Lab
Gene Symbol Vmn2r103
Ensembl Gene ENSMUSG00000091771
Gene Namevomeronasal 2, receptor 103
SynonymsEG627636
MMRRC Submission 039627-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R1590 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location19773363-19812536 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 19794234 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 429 (M429I)
Ref Sequence ENSEMBL: ENSMUSP00000126756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172203]
Predicted Effect probably benign
Transcript: ENSMUST00000172203
AA Change: M429I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126756
Gene: ENSMUSG00000091771
AA Change: M429I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 449 1.3e-37 PFAM
Pfam:NCD3G 509 562 3.5e-22 PFAM
Pfam:7tm_3 595 830 1.1e-51 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.4%
Validation Efficiency 97% (69/71)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik A T 8: 84,167,086 Q294L probably benign Het
Aamp A G 1: 74,283,211 S95P probably damaging Het
Ankmy1 T C 1: 92,888,675 Y239C probably damaging Het
Atp12a T C 14: 56,380,055 S601P probably damaging Het
Atp1b3 T C 9: 96,343,349 T89A probably benign Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
Btnl2 A T 17: 34,361,140 I216F possibly damaging Het
Cabs1 A T 5: 87,979,631 H47L probably damaging Het
Ccdc68 T A 18: 69,940,180 D66E probably benign Het
Cdc42ep4 T C 11: 113,728,566 D333G possibly damaging Het
Ckmt1 G A 2: 121,363,522 D389N possibly damaging Het
Dact1 G T 12: 71,317,575 V340F probably benign Het
Dnah2 A G 11: 69,422,754 probably null Het
Dnah2 T C 11: 69,521,198 T246A probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Efcab14 A G 4: 115,756,549 probably benign Het
Eprs A G 1: 185,401,510 T795A probably damaging Het
Esp36 T A 17: 38,417,311 E26D possibly damaging Het
Fpr-rs7 T C 17: 20,113,416 T271A probably benign Het
Fsip2 A T 2: 82,982,787 H3150L probably benign Het
Gimap7 G A 6: 48,724,019 V180M probably damaging Het
Gm6614 C T 6: 141,980,872 S576N probably benign Het
Gtf3c1 T C 7: 125,676,661 H531R possibly damaging Het
Herc1 T A 9: 66,491,953 probably benign Het
Hip1r A G 5: 124,002,140 Y1061C probably benign Het
Ipo11 T C 13: 106,886,717 Y420C probably damaging Het
Ipo8 T C 6: 148,810,665 probably null Het
Itga10 C T 3: 96,651,738 probably benign Het
Klhl1 A T 14: 96,368,636 M243K probably damaging Het
Lrp2 A G 2: 69,466,763 probably null Het
Mag T C 7: 30,901,852 E439G probably damaging Het
Mcm3ap T A 10: 76,496,541 F1231I probably benign Het
Mcmdc2 C T 1: 9,916,555 Q204* probably null Het
Mpl A C 4: 118,444,024 L548R probably damaging Het
Mrps2 C T 2: 28,469,488 A119V probably benign Het
Myo18b G A 5: 112,875,266 Q87* probably null Het
Nfat5 A G 8: 107,293,890 Y22C probably damaging Het
Nnt T A 13: 119,386,661 I232L possibly damaging Het
Olfr12 G A 1: 92,620,745 V280M possibly damaging Het
Olfr146 T C 9: 39,018,957 N195D probably benign Het
Olfr437 A G 6: 43,167,912 N285D probably damaging Het
Parp2 C T 14: 50,810,544 P76S probably benign Het
Pick1 C T 15: 79,245,301 H169Y probably benign Het
Prtg T A 9: 72,842,807 F164L probably benign Het
Pygb A G 2: 150,817,663 D422G possibly damaging Het
Samd9l C A 6: 3,375,761 C500F probably benign Het
Sbno1 A C 5: 124,384,504 N1083K possibly damaging Het
Sept7 C T 9: 25,277,604 S77F probably damaging Het
Slc25a44 A G 3: 88,416,007 V264A possibly damaging Het
Slf2 G T 19: 44,942,073 E530* probably null Het
Svs2 A G 2: 164,237,658 S110P possibly damaging Het
Tmbim7 G T 5: 3,665,338 probably null Het
Tpgs2 T C 18: 25,140,573 D177G probably damaging Het
Uba1y T A Y: 826,893 F516L probably damaging Het
Ulk1 A G 5: 110,795,766 V211A probably damaging Het
Vmn1r237 T A 17: 21,314,039 I8N probably damaging Het
Vmn2r112 T C 17: 22,615,008 probably null Het
Vmn2r84 T C 10: 130,391,480 probably null Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Other mutations in Vmn2r103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Vmn2r103 APN 17 19793102 missense probably damaging 0.98
IGL00939:Vmn2r103 APN 17 19794965 missense probably benign 0.00
IGL01120:Vmn2r103 APN 17 19792997 missense probably benign 0.06
IGL01403:Vmn2r103 APN 17 19792967 missense probably benign
IGL01404:Vmn2r103 APN 17 19812434 missense probably damaging 1.00
IGL01713:Vmn2r103 APN 17 19794068 missense probably damaging 1.00
IGL01802:Vmn2r103 APN 17 19799208 missense probably benign
IGL02251:Vmn2r103 APN 17 19793969 missense possibly damaging 0.84
IGL02466:Vmn2r103 APN 17 19773369 missense probably benign
IGL02555:Vmn2r103 APN 17 19811611 missense probably damaging 1.00
IGL02668:Vmn2r103 APN 17 19794127 missense probably benign 0.03
IGL02715:Vmn2r103 APN 17 19793956 missense probably damaging 0.97
IGL02735:Vmn2r103 APN 17 19812248 missense probably benign 0.27
IGL03101:Vmn2r103 APN 17 19773520 missense probably damaging 0.98
R0003:Vmn2r103 UTSW 17 19811979 missense probably damaging 0.99
R0052:Vmn2r103 UTSW 17 19811641 missense probably benign 0.01
R0375:Vmn2r103 UTSW 17 19792859 missense probably benign 0.06
R0375:Vmn2r103 UTSW 17 19793464 missense probably benign 0.12
R0755:Vmn2r103 UTSW 17 19773568 missense probably benign 0.01
R0837:Vmn2r103 UTSW 17 19793927 missense probably damaging 0.99
R1345:Vmn2r103 UTSW 17 19794247 missense probably damaging 1.00
R1396:Vmn2r103 UTSW 17 19792968 missense probably benign
R1488:Vmn2r103 UTSW 17 19793660 missense probably damaging 0.97
R1533:Vmn2r103 UTSW 17 19773400 missense probably benign 0.01
R1928:Vmn2r103 UTSW 17 19811767 missense possibly damaging 0.95
R1942:Vmn2r103 UTSW 17 19812300 missense probably benign 0.02
R2071:Vmn2r103 UTSW 17 19793794 missense probably benign
R2219:Vmn2r103 UTSW 17 19793647 missense probably damaging 1.00
R2442:Vmn2r103 UTSW 17 19773531 missense probably benign 0.00
R2889:Vmn2r103 UTSW 17 19793600 missense probably damaging 1.00
R3762:Vmn2r103 UTSW 17 19812149 missense probably damaging 0.98
R4014:Vmn2r103 UTSW 17 19793604 missense possibly damaging 0.67
R4331:Vmn2r103 UTSW 17 19794233 missense probably benign 0.00
R4630:Vmn2r103 UTSW 17 19793696 missense probably benign 0.04
R4631:Vmn2r103 UTSW 17 19793696 missense probably benign 0.04
R4632:Vmn2r103 UTSW 17 19793696 missense probably benign 0.04
R4660:Vmn2r103 UTSW 17 19811815 missense probably damaging 1.00
R4801:Vmn2r103 UTSW 17 19795076 missense probably benign 0.06
R4802:Vmn2r103 UTSW 17 19795076 missense probably benign 0.06
R4931:Vmn2r103 UTSW 17 19811769 missense probably benign 0.01
R4995:Vmn2r103 UTSW 17 19773511 missense probably benign 0.14
R5309:Vmn2r103 UTSW 17 19793034 missense probably benign 0.01
R5312:Vmn2r103 UTSW 17 19793034 missense probably benign 0.01
R5329:Vmn2r103 UTSW 17 19812171 missense probably damaging 1.00
R5611:Vmn2r103 UTSW 17 19793642 missense probably damaging 0.99
R5684:Vmn2r103 UTSW 17 19792989 missense probably benign 0.02
R5715:Vmn2r103 UTSW 17 19794939 missense probably benign 0.17
R5907:Vmn2r103 UTSW 17 19812453 missense possibly damaging 0.67
R6029:Vmn2r103 UTSW 17 19794216 nonsense probably null
R6114:Vmn2r103 UTSW 17 19812325 missense probably damaging 0.99
R6285:Vmn2r103 UTSW 17 19812144 missense probably benign
R6292:Vmn2r103 UTSW 17 19793604 missense possibly damaging 0.67
R6334:Vmn2r103 UTSW 17 19794082 missense probably damaging 0.97
R6501:Vmn2r103 UTSW 17 19811904 missense probably benign 0.29
R6710:Vmn2r103 UTSW 17 19811977 missense probably damaging 1.00
R6774:Vmn2r103 UTSW 17 19773511 missense probably benign 0.14
R6981:Vmn2r103 UTSW 17 19793477 missense probably benign 0.00
R7768:Vmn2r103 UTSW 17 19812052 missense probably damaging 0.99
R7816:Vmn2r103 UTSW 17 19794214 missense probably benign 0.06
R7885:Vmn2r103 UTSW 17 19793123 missense probably benign 0.25
R7968:Vmn2r103 UTSW 17 19793123 missense probably benign 0.25
R8002:Vmn2r103 UTSW 17 19799249 missense not run
R8031:Vmn2r103 UTSW 17 19793497 missense not run
Z1088:Vmn2r103 UTSW 17 19795047 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CAGCCACATGGACTTCACATTTTGC -3'
(R):5'- TGCTCCTGGTATGTTACACACGATTTC -3'

Sequencing Primer
(F):5'- CACAGAATGTCTGGATCATGAAC -3'
(R):5'- CAGAACATCATTCACTGGAATTGAC -3'
Posted On2014-04-24