Incidental Mutation 'R1590:Fpr-rs7'
ID 177829
Institutional Source Beutler Lab
Gene Symbol Fpr-rs7
Ensembl Gene ENSMUSG00000071276
Gene Name formyl peptide receptor, related sequence 7
Synonyms
MMRRC Submission 039627-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R1590 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 20333472-20334488 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20333678 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 271 (T271A)
Ref Sequence ENSEMBL: ENSMUSP00000093297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095637]
AlphaFold Q71MR7
Predicted Effect probably benign
Transcript: ENSMUST00000095637
AA Change: T271A

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000093297
Gene: ENSMUSG00000071276
AA Change: T271A

DomainStartEndE-ValueType
Pfam:7tm_1 43 297 1.2e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176711
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.4%
Validation Efficiency 97% (69/71)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,322,370 (GRCm39) S95P probably damaging Het
Ankmy1 T C 1: 92,816,397 (GRCm39) Y239C probably damaging Het
Atp12a T C 14: 56,617,512 (GRCm39) S601P probably damaging Het
Atp1b3 T C 9: 96,225,402 (GRCm39) T89A probably benign Het
B3galt4 G A 17: 34,169,813 (GRCm39) R142C probably damaging Het
Brme1 A T 8: 84,893,715 (GRCm39) Q294L probably benign Het
Btnl2 A T 17: 34,580,114 (GRCm39) I216F possibly damaging Het
Cabs1 A T 5: 88,127,490 (GRCm39) H47L probably damaging Het
Ccdc68 T A 18: 70,073,251 (GRCm39) D66E probably benign Het
Cdc42ep4 T C 11: 113,619,392 (GRCm39) D333G possibly damaging Het
Ckmt1 G A 2: 121,194,003 (GRCm39) D389N possibly damaging Het
Dact1 G T 12: 71,364,349 (GRCm39) V340F probably benign Het
Dnah2 T C 11: 69,412,024 (GRCm39) T246A probably benign Het
Dnah2 A G 11: 69,313,580 (GRCm39) probably null Het
Ecm1 G A 3: 95,643,275 (GRCm39) R342C probably damaging Het
Efcab14 A G 4: 115,613,746 (GRCm39) probably benign Het
Eprs1 A G 1: 185,133,707 (GRCm39) T795A probably damaging Het
Esp36 T A 17: 38,728,202 (GRCm39) E26D possibly damaging Het
Fsip2 A T 2: 82,813,131 (GRCm39) H3150L probably benign Het
Gimap7 G A 6: 48,700,953 (GRCm39) V180M probably damaging Het
Gtf3c1 T C 7: 125,275,833 (GRCm39) H531R possibly damaging Het
Herc1 T A 9: 66,399,235 (GRCm39) probably benign Het
Hip1r A G 5: 124,140,203 (GRCm39) Y1061C probably benign Het
Ipo11 T C 13: 107,023,225 (GRCm39) Y420C probably damaging Het
Ipo8 T C 6: 148,712,163 (GRCm39) probably null Het
Itga10 C T 3: 96,559,054 (GRCm39) probably benign Het
Klhl1 A T 14: 96,606,072 (GRCm39) M243K probably damaging Het
Lrp2 A G 2: 69,297,107 (GRCm39) probably null Het
Mag T C 7: 30,601,277 (GRCm39) E439G probably damaging Het
Mcm3ap T A 10: 76,332,375 (GRCm39) F1231I probably benign Het
Mcmdc2 C T 1: 9,986,780 (GRCm39) Q204* probably null Het
Mpl A C 4: 118,301,221 (GRCm39) L548R probably damaging Het
Mrps2 C T 2: 28,359,500 (GRCm39) A119V probably benign Het
Myo18b G A 5: 113,023,132 (GRCm39) Q87* probably null Het
Nfat5 A G 8: 108,020,522 (GRCm39) Y22C probably damaging Het
Nnt T A 13: 119,523,197 (GRCm39) I232L possibly damaging Het
Or2a52 A G 6: 43,144,846 (GRCm39) N285D probably damaging Het
Or8g17 T C 9: 38,930,253 (GRCm39) N195D probably benign Het
Or9s13 G A 1: 92,548,467 (GRCm39) V280M possibly damaging Het
Parp2 C T 14: 51,048,001 (GRCm39) P76S probably benign Het
Pick1 C T 15: 79,129,501 (GRCm39) H169Y probably benign Het
Prtg T A 9: 72,750,089 (GRCm39) F164L probably benign Het
Pygb A G 2: 150,659,583 (GRCm39) D422G possibly damaging Het
Samd9l C A 6: 3,375,761 (GRCm39) C500F probably benign Het
Sbno1 A C 5: 124,522,567 (GRCm39) N1083K possibly damaging Het
Septin7 C T 9: 25,188,900 (GRCm39) S77F probably damaging Het
Slc25a44 A G 3: 88,323,314 (GRCm39) V264A possibly damaging Het
Slco1a8 C T 6: 141,926,598 (GRCm39) S576N probably benign Het
Slf2 G T 19: 44,930,512 (GRCm39) E530* probably null Het
Svs5 A G 2: 164,079,578 (GRCm39) S110P possibly damaging Het
Tmbim7 G T 5: 3,715,338 (GRCm39) probably null Het
Tpgs2 T C 18: 25,273,630 (GRCm39) D177G probably damaging Het
Uba1y T A Y: 826,893 (GRCm39) F516L probably damaging Het
Ulk1 A G 5: 110,943,632 (GRCm39) V211A probably damaging Het
Vmn1r237 T A 17: 21,534,301 (GRCm39) I8N probably damaging Het
Vmn2r103 G T 17: 20,014,496 (GRCm39) M429I probably benign Het
Vmn2r112 T C 17: 22,833,989 (GRCm39) probably null Het
Vmn2r84 T C 10: 130,227,349 (GRCm39) probably null Het
Vwa8 C T 14: 79,145,670 (GRCm39) R116C probably damaging Het
Other mutations in Fpr-rs7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Fpr-rs7 APN 17 20,333,480 (GRCm39) nonsense probably null
IGL01386:Fpr-rs7 APN 17 20,334,454 (GRCm39) missense probably damaging 0.98
IGL02293:Fpr-rs7 APN 17 20,334,232 (GRCm39) missense probably benign 0.01
IGL03303:Fpr-rs7 APN 17 20,334,001 (GRCm39) missense possibly damaging 0.55
R0731:Fpr-rs7 UTSW 17 20,334,116 (GRCm39) missense probably benign 0.00
R0826:Fpr-rs7 UTSW 17 20,333,888 (GRCm39) missense probably benign 0.01
R1439:Fpr-rs7 UTSW 17 20,333,869 (GRCm39) missense probably benign 0.10
R1778:Fpr-rs7 UTSW 17 20,334,277 (GRCm39) missense probably damaging 1.00
R4715:Fpr-rs7 UTSW 17 20,333,690 (GRCm39) missense probably benign 0.00
R4744:Fpr-rs7 UTSW 17 20,334,265 (GRCm39) missense probably benign 0.17
R4921:Fpr-rs7 UTSW 17 20,334,082 (GRCm39) missense possibly damaging 0.70
R5540:Fpr-rs7 UTSW 17 20,334,356 (GRCm39) missense probably damaging 1.00
R5677:Fpr-rs7 UTSW 17 20,334,365 (GRCm39) missense probably benign
R5959:Fpr-rs7 UTSW 17 20,334,011 (GRCm39) missense probably benign 0.01
R6042:Fpr-rs7 UTSW 17 20,333,477 (GRCm39) missense probably benign 0.00
R7921:Fpr-rs7 UTSW 17 20,333,667 (GRCm39) missense probably benign 0.03
R7984:Fpr-rs7 UTSW 17 20,333,671 (GRCm39) missense probably benign 0.01
R8137:Fpr-rs7 UTSW 17 20,334,055 (GRCm39) missense possibly damaging 0.49
R8172:Fpr-rs7 UTSW 17 20,334,443 (GRCm39) missense probably benign 0.04
R8762:Fpr-rs7 UTSW 17 20,333,789 (GRCm39) missense probably benign 0.07
R9134:Fpr-rs7 UTSW 17 20,334,325 (GRCm39) missense probably damaging 1.00
Z1176:Fpr-rs7 UTSW 17 20,333,655 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGCACAGGAAACATTTCCATGACAC -3'
(R):5'- GCAATTTTGAATCCTGGGCTGCAAC -3'

Sequencing Primer
(F):5'- TCAGGTCCTATGTCTCAGAGTC -3'
(R):5'- GTTGGCTTCAGCATACCAATG -3'
Posted On 2014-04-24