Mutagenetix > Incidental Mutations

Incidental Mutation 'R1590:Tpgs2'

177835

Institutional Source

Beutler Lab

Gene Symbol

Tpgs2

Ensembl Gene

ENSMUSG00000024269

Gene Name

tubulin polyglutamylase complex subunit 2

Synonyms

MMRRC Submission

039627-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1590 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25127223-25169007 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 25140573 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 177 (D177G)

Ref Sequence

ENSEMBL: ENSMUSP00000122538 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115817] [ENSMUST00000148255]

Predicted Effect

probably damaging
Transcript: ENSMUST00000115817
AA Change: D177G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000111484
Gene: ENSMUSG00000024269
AA Change: D177G

Domain	Start	End	E-Value	Type
SMI1_KNR4	43	187	1.04e-3	SMART
low complexity region	253	264	N/A	INTRINSIC
low complexity region	271	293	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000148255
AA Change: D177G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000122538
Gene: ENSMUSG00000024269
AA Change: D177G

Domain	Start	End	E-Value	Type
SMI1_KNR4	43	187	1.04e-3	SMART

Meta Mutation Damage Score

0.9465

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.0%
20x: 91.4%

Validation Efficiency

97% (69/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a component of the neuronal polyglutamylase complex, which plays a role in post-translational addition of glutamate residues to C-terminal tubulin tails. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2012]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432K21Rik	A	T	8: 84,167,086	Q294L	probably benign	Het
Aamp	A	G	1: 74,283,211	S95P	probably damaging	Het
Ankmy1	T	C	1: 92,888,675	Y239C	probably damaging	Het
Atp12a	T	C	14: 56,380,055	S601P	probably damaging	Het
Atp1b3	T	C	9: 96,343,349	T89A	probably benign	Het
B3galt4	G	A	17: 33,950,839	R142C	probably damaging	Het
Btnl2	A	T	17: 34,361,140	I216F	possibly damaging	Het
Cabs1	A	T	5: 87,979,631	H47L	probably damaging	Het
Ccdc68	T	A	18: 69,940,180	D66E	probably benign	Het
Cdc42ep4	T	C	11: 113,728,566	D333G	possibly damaging	Het
Ckmt1	G	A	2: 121,363,522	D389N	possibly damaging	Het
Dact1	G	T	12: 71,317,575	V340F	probably benign	Het
Dnah2	A	G	11: 69,422,754		probably null	Het
Dnah2	T	C	11: 69,521,198	T246A	probably benign	Het
Ecm1	G	A	3: 95,735,963	R342C	probably damaging	Het
Efcab14	A	G	4: 115,756,549		probably benign	Het
Eprs	A	G	1: 185,401,510	T795A	probably damaging	Het
Esp36	T	A	17: 38,417,311	E26D	possibly damaging	Het
Fpr-rs7	T	C	17: 20,113,416	T271A	probably benign	Het
Fsip2	A	T	2: 82,982,787	H3150L	probably benign	Het
Gimap7	G	A	6: 48,724,019	V180M	probably damaging	Het
Gm6614	C	T	6: 141,980,872	S576N	probably benign	Het
Gtf3c1	T	C	7: 125,676,661	H531R	possibly damaging	Het
Herc1	T	A	9: 66,491,953		probably benign	Het
Hip1r	A	G	5: 124,002,140	Y1061C	probably benign	Het
Ipo11	T	C	13: 106,886,717	Y420C	probably damaging	Het
Ipo8	T	C	6: 148,810,665		probably null	Het
Itga10	C	T	3: 96,651,738		probably benign	Het
Klhl1	A	T	14: 96,368,636	M243K	probably damaging	Het
Lrp2	A	G	2: 69,466,763		probably null	Het
Mag	T	C	7: 30,901,852	E439G	probably damaging	Het
Mcm3ap	T	A	10: 76,496,541	F1231I	probably benign	Het
Mcmdc2	C	T	1: 9,916,555	Q204*	probably null	Het
Mpl	A	C	4: 118,444,024	L548R	probably damaging	Het
Mrps2	C	T	2: 28,469,488	A119V	probably benign	Het
Myo18b	G	A	5: 112,875,266	Q87*	probably null	Het
Nfat5	A	G	8: 107,293,890	Y22C	probably damaging	Het
Nnt	T	A	13: 119,386,661	I232L	possibly damaging	Het
Olfr12	G	A	1: 92,620,745	V280M	possibly damaging	Het
Olfr146	T	C	9: 39,018,957	N195D	probably benign	Het
Olfr437	A	G	6: 43,167,912	N285D	probably damaging	Het
Parp2	C	T	14: 50,810,544	P76S	probably benign	Het
Pick1	C	T	15: 79,245,301	H169Y	probably benign	Het
Prtg	T	A	9: 72,842,807	F164L	probably benign	Het
Pygb	A	G	2: 150,817,663	D422G	possibly damaging	Het
Samd9l	C	A	6: 3,375,761	C500F	probably benign	Het
Sbno1	A	C	5: 124,384,504	N1083K	possibly damaging	Het
Sept7	C	T	9: 25,277,604	S77F	probably damaging	Het
Slc25a44	A	G	3: 88,416,007	V264A	possibly damaging	Het
Slf2	G	T	19: 44,942,073	E530*	probably null	Het
Svs2	A	G	2: 164,237,658	S110P	possibly damaging	Het
Tmbim7	G	T	5: 3,665,338		probably null	Het
Uba1y	T	A	Y: 826,893	F516L	probably damaging	Het
Ulk1	A	G	5: 110,795,766	V211A	probably damaging	Het
Vmn1r237	T	A	17: 21,314,039	I8N	probably damaging	Het
Vmn2r103	G	T	17: 19,794,234	M429I	probably benign	Het
Vmn2r112	T	C	17: 22,615,008		probably null	Het
Vmn2r84	T	C	10: 130,391,480		probably null	Het
Vwa8	C	T	14: 78,908,230	R116C	probably damaging	Het

Other mutations in Tpgs2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02160:Tpgs2	APN	18	25140580	missense	possibly damaging	0.93
IGL02184:Tpgs2	APN	18	25140573	missense	probably damaging	1.00
IGL02234:Tpgs2	APN	18	25149244	critical splice acceptor site	probably null
IGL02747:Tpgs2	APN	18	25139145	intron	probably benign
PIT4466001:Tpgs2	UTSW	18	25168595	missense	possibly damaging	0.77
PIT4472001:Tpgs2	UTSW	18	25168595	missense	possibly damaging	0.77
R0004:Tpgs2	UTSW	18	25158238	splice site	probably benign
R0139:Tpgs2	UTSW	18	25149185	missense	probably damaging	1.00
R0898:Tpgs2	UTSW	18	25149150	missense	probably damaging	1.00
R1415:Tpgs2	UTSW	18	25168553	missense	probably damaging	1.00
R1974:Tpgs2	UTSW	18	25140536	missense	probably damaging	1.00
R2144:Tpgs2	UTSW	18	25168541	missense	possibly damaging	0.93
R4811:Tpgs2	UTSW	18	25129840	intron	probably benign
R4851:Tpgs2	UTSW	18	25151248	missense	possibly damaging	0.94
R6386:Tpgs2	UTSW	18	25139024	missense	possibly damaging	0.74
R6564:Tpgs2	UTSW	18	25158287	missense	probably damaging	0.99
R6788:Tpgs2	UTSW	18	25129870	missense	probably benign	0.04
R7112:Tpgs2	UTSW	18	25149137	missense	probably damaging	1.00
R7824:Tpgs2	UTSW	18	25129865	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACACTACACTGACAACTATGCCGGG -3'
(R):5'- TAATGAGCTGCCACAGGGCCAAAG -3'

Sequencing Primer
(F):5'- GCATACCTGGAGACTTGTCAATC -3'
(R):5'- CACGGGCTGATCTCTGAGTATC -3'

Posted On

2014-04-24