Mutagenetix > Incidental Mutations

Incidental Mutation 'R0411:Cd55'

177845

Institutional Source

Beutler Lab

Gene Symbol

Cd55

Ensembl Gene

ENSMUSG00000026399

Gene Name

CD55 molecule, decay accelerating factor for complement

Synonyms

complement-glycosylphosphatidylinositol, Daf1, Cromer blood group, GPI-DAF, Daf-GPI

MMRRC Submission

038613-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0411 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

130439027-130462744 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 130462557 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000027650 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027650]

Predicted Effect

probably benign
Transcript: ENSMUST00000027650

SMART Domains

Protein: ENSMUSP00000027650
Gene: ENSMUSG00000026399

Domain	Start	End	E-Value	Type
low complexity region	11	30	N/A	INTRINSIC
CCP	36	94	2.21e-12	SMART
CCP	98	158	3.56e-7	SMART
CCP	163	220	6.34e-13	SMART
CCP	225	284	1.28e-17	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125681

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133057

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140725

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

97% (66/68)

MGI Phenotype

FUNCTION: This gene encodes an inhibitor of both the classical and the alternative pathways of complement activation. The encoded preproprotein undergoes post-translational processing to generate a mature polypeptide anchored to the plasma membrane via a glycosylphosphatidylinositol moiety. Erythrocytes from mice deficient in the encoded protein exhibit impaired regulation of complement activation resulting in enhanced complement deposition. Mice lacking the encoded protein exhibit enhanced susceptibility to experimentally induced myasthenia gravis. This gene is located adjacent to a closely related gene on chromosome 1. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous mutant mice show increased susceptibility to injury following ethanol exposure, to experimental autoimmune myasthenia gravis and to acute nephrotoxic nephritis. Another allele results in an abnormal complement cascade leading to increased C3 deposition. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	A	G	5: 63,896,491		probably benign	Het
6030469F06Rik	A	T	12: 31,184,731		noncoding transcript	Het
Acad11	T	C	9: 104,116,296	F541L	probably damaging	Het
Acin1	G	T	14: 54,646,774	R92S	probably damaging	Het
Appl1	A	G	14: 26,940,256	S490P	probably benign	Het
Aqp9	C	A	9: 71,130,444	V184L	probably benign	Het
Arih1	A	T	9: 59,485,983	I122N	possibly damaging	Het
Bmi1	T	C	2: 18,683,172		probably benign	Het
Bmpr1a	G	A	14: 34,415,877	T391I	possibly damaging	Het
Cacna1s	A	G	1: 136,113,303	K1256E	probably damaging	Het
Cacng3	C	T	7: 122,768,572	P225L	probably damaging	Het
Cd101	A	T	3: 101,018,527		probably null	Het
Cenpe	T	C	3: 135,222,255	I258T	probably damaging	Het
Cma2	A	G	14: 55,973,678		probably benign	Het
Ddost	T	A	4: 138,309,653	S176T	probably benign	Het
Ddx19b	A	T	8: 111,023,964		probably null	Het
Dmxl2	A	G	9: 54,378,939	I2681T	probably damaging	Het
Ern1	C	T	11: 106,398,586	E964K	probably benign	Het
Galntl5	C	T	5: 25,220,174	R430C	probably benign	Het
Gga3	A	G	11: 115,587,433	L511P	probably damaging	Het
Gm7271	G	T	5: 76,500,487	V47L	possibly damaging	Het
Gria2	C	T	3: 80,710,858		probably benign	Het
Hmbs	A	T	9: 44,341,652	L28*	probably null	Het
Iffo2	A	G	4: 139,603,221	E220G	probably damaging	Het
Ifi30	A	G	8: 70,764,918		probably benign	Het
Irf2	T	A	8: 46,846,061	C297S	probably benign	Het
Izumo4	T	C	10: 80,703,084	Y94H	probably damaging	Het
Klhdc9	A	G	1: 171,359,785	V215A	probably benign	Het
Kmt2a	T	C	9: 44,819,964		probably benign	Het
Kmt2c	A	T	5: 25,375,957	C513S	probably damaging	Het
Lyg1	A	T	1: 37,949,896	M81K	possibly damaging	Het
Maip1	T	G	1: 57,415,693	W279G	probably damaging	Het
Myo7a	T	C	7: 98,071,937	T1263A	probably benign	Het
Naa15	T	A	3: 51,465,639	I701N	possibly damaging	Het
Ncoa3	A	G	2: 166,068,543	N1292S	probably benign	Het
Necab2	T	A	8: 119,454,240		probably benign	Het
Nfatc1	T	A	18: 80,698,042	I234F	possibly damaging	Het
Olfm1	G	A	2: 28,208,211	R95K	possibly damaging	Het
Olfr1118	A	G	2: 87,309,058	T90A	probably benign	Het
Olfr1329	A	T	4: 118,916,626	N280K	possibly damaging	Het
Otoa	T	C	7: 121,156,527		probably null	Het
Padi4	GCTGCGTACCTCCAC	GC	4: 140,748,449		probably benign	Het
Pard6g	A	G	18: 80,117,122	D150G	probably damaging	Het
Pax5	A	G	4: 44,609,783	L215S	probably damaging	Het
Pja2	A	T	17: 64,287,521		probably benign	Het
Plk4	T	A	3: 40,811,219		probably benign	Het
Polr1a	A	T	6: 71,978,421	H1687L	possibly damaging	Het
Ptcd2	G	A	13: 99,343,391	L41F	probably damaging	Het
Ropn1	T	A	16: 34,669,964	S62T	probably benign	Het
Setd1a	T	C	7: 127,796,051		probably benign	Het
Setdb1	T	C	3: 95,327,686	D902G	probably damaging	Het
Sik3	T	A	9: 46,208,770	L719Q	probably damaging	Het
Slc36a1	G	T	11: 55,232,507	V433F	probably benign	Het
Slc6a3	T	C	13: 73,557,050	V220A	possibly damaging	Het
Slc6a5	A	T	7: 49,911,791	R24W	probably damaging	Het
Smox	G	T	2: 131,520,644	R281L	probably benign	Het
Sulf2	G	T	2: 166,093,516	H226N	probably damaging	Het
Syne2	C	T	12: 76,059,584		probably null	Het
Tenm3	C	T	8: 48,287,791	S1210N	possibly damaging	Het
Tns1	A	T	1: 73,925,761	V1237E	probably damaging	Het
Trf	C	T	9: 103,217,501	V92M	probably damaging	Het
Ttn	A	G	2: 76,709,373	V34423A	possibly damaging	Het
Vmn2r118	A	G	17: 55,611,021		probably benign	Het
Vmn2r19	A	G	6: 123,309,744	Y112C	probably damaging	Het
Wdr66	C	T	5: 123,290,054	T538M	probably damaging	Het
Zfp326	G	T	5: 105,878,775	A15S	possibly damaging	Het

Other mutations in Cd55

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00809:Cd55	APN	1	130452511	nonsense	probably null
IGL02207:Cd55	APN	1	130452419	missense	possibly damaging	0.46
IGL02724:Cd55	APN	1	130449412	splice site	probably benign
IGL02933:Cd55	APN	1	130452524	missense	probably damaging	1.00
IGL02955:Cd55	APN	1	130449482	missense	probably damaging	0.98
IGL03198:Cd55	APN	1	130440371	missense	probably benign	0.03
PIT4618001:Cd55	UTSW	1	130456869	missense	probably benign
R0055:Cd55	UTSW	1	130459576	splice site	probably benign
R0426:Cd55	UTSW	1	130448372	missense	probably benign	0.07
R1488:Cd55	UTSW	1	130448378	missense	probably damaging	0.98
R1728:Cd55	UTSW	1	130449423	missense	probably benign	0.32
R1728:Cd55	UTSW	1	130459633	missense	probably benign
R1729:Cd55	UTSW	1	130449423	missense	probably benign	0.32
R1729:Cd55	UTSW	1	130459633	missense	probably benign
R1730:Cd55	UTSW	1	130449423	missense	probably benign	0.32
R1730:Cd55	UTSW	1	130459633	missense	probably benign
R1739:Cd55	UTSW	1	130449423	missense	probably benign	0.32
R1739:Cd55	UTSW	1	130459633	missense	probably benign
R1762:Cd55	UTSW	1	130449423	missense	probably benign	0.32
R1762:Cd55	UTSW	1	130459633	missense	probably benign
R1783:Cd55	UTSW	1	130449423	missense	probably benign	0.32
R1783:Cd55	UTSW	1	130459633	missense	probably benign
R1784:Cd55	UTSW	1	130449423	missense	probably benign	0.32
R1784:Cd55	UTSW	1	130459633	missense	probably benign
R1785:Cd55	UTSW	1	130449423	missense	probably benign	0.32
R1785:Cd55	UTSW	1	130459633	missense	probably benign
R1835:Cd55	UTSW	1	130447609	splice site	probably benign
R2049:Cd55	UTSW	1	130449423	missense	probably benign	0.32
R2122:Cd55	UTSW	1	130459617	missense	possibly damaging	0.94
R2141:Cd55	UTSW	1	130449423	missense	probably benign	0.32
R2142:Cd55	UTSW	1	130449423	missense	probably benign	0.32
R2935:Cd55	UTSW	1	130452426	missense	possibly damaging	0.65
R4326:Cd55	UTSW	1	130452483	missense	probably damaging	1.00
R4328:Cd55	UTSW	1	130447367	intron	probably benign
R4328:Cd55	UTSW	1	130452483	missense	probably damaging	1.00
R4329:Cd55	UTSW	1	130452483	missense	probably damaging	1.00
R5051:Cd55	UTSW	1	130448348	missense	probably damaging	0.99
R6467:Cd55	UTSW	1	130447611	splice site	probably benign
R7219:Cd55	UTSW	1	130462606	missense	possibly damaging	0.73
R8010:Cd55	UTSW	1	130459616	missense	probably benign	0.00
Z1088:Cd55	UTSW	1	130452479	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CCTCAGGAACTTGGAATGCTTGGAC -3'
(R):5'- TGCTCAATTAACTGCGGCTCAAAAC -3'

Sequencing Primer
(F):5'- AATGCTTGGACTCTCGTGAAC -3'
(R):5'- TGCGGCTCAAAACAGCTC -3'

Posted On

2014-04-29