Incidental Mutation 'R0399:Gpr155'
ID177848
Institutional Source Beutler Lab
Gene Symbol Gpr155
Ensembl Gene ENSMUSG00000041762
Gene NameG protein-coupled receptor 155
SynonymsPGR22, 1110017O10Rik, DEPDC3, F730029F15Rik
MMRRC Submission 038604-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0399 (G1)
Quality Score80
Status Validated
Chromosome2
Chromosomal Location73341506-73386572 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73370002 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 387 (I387N)
Ref Sequence ENSEMBL: ENSMUSP00000107674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076463] [ENSMUST00000112043] [ENSMUST00000112044]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000048504
SMART Domains Protein: ENSMUSP00000037772
Gene: ENSMUSG00000041762

DomainStartEndE-ValueType
Pfam:Mem_trans 40 205 1.9e-16 PFAM
Pfam:Mem_trans 187 360 4.9e-12 PFAM
transmembrane domain 380 402 N/A INTRINSIC
transmembrane domain 415 432 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 519 538 N/A INTRINSIC
transmembrane domain 657 679 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000076463
AA Change: I387N

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000075788
Gene: ENSMUSG00000041762
AA Change: I387N

DomainStartEndE-ValueType
Pfam:Mem_trans 40 205 3.3e-15 PFAM
transmembrane domain 209 231 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 272 291 N/A INTRINSIC
transmembrane domain 311 330 N/A INTRINSIC
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 380 402 N/A INTRINSIC
transmembrane domain 415 432 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 519 538 N/A INTRINSIC
transmembrane domain 657 679 N/A INTRINSIC
transmembrane domain 689 711 N/A INTRINSIC
DEP 759 833 8.28e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112043
AA Change: I387N

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107674
Gene: ENSMUSG00000041762
AA Change: I387N

DomainStartEndE-ValueType
Pfam:Mem_trans 40 205 3.3e-15 PFAM
transmembrane domain 209 231 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 272 291 N/A INTRINSIC
transmembrane domain 311 330 N/A INTRINSIC
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 380 402 N/A INTRINSIC
transmembrane domain 415 432 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 519 538 N/A INTRINSIC
transmembrane domain 657 679 N/A INTRINSIC
transmembrane domain 689 711 N/A INTRINSIC
DEP 759 833 8.28e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112044
AA Change: I387N

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107675
Gene: ENSMUSG00000041762
AA Change: I387N

DomainStartEndE-ValueType
Pfam:Mem_trans 40 205 3.3e-15 PFAM
Pfam:Mem_trans 187 360 8.3e-11 PFAM
transmembrane domain 382 404 N/A INTRINSIC
transmembrane domain 414 436 N/A INTRINSIC
transmembrane domain 449 471 N/A INTRINSIC
transmembrane domain 491 510 N/A INTRINSIC
transmembrane domain 629 651 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
DEP 731 805 8.28e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184503
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 99% (71/72)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,750,959 probably benign Het
6030452D12Rik T C 8: 106,504,542 M120T unknown Het
Actr1a A T 19: 46,385,011 probably null Het
AI314180 T C 4: 58,827,047 T1029A possibly damaging Het
Anapc5 A T 5: 122,791,753 V555D probably damaging Het
Aox1 A G 1: 58,068,849 probably null Het
Arhgap30 A G 1: 171,404,816 E343G probably damaging Het
Asap2 C T 12: 21,217,997 T291I possibly damaging Het
Atp5a1 T A 18: 77,781,836 Y439* probably null Het
Auts2 A T 5: 131,440,524 S428T probably benign Het
B3gnt7 T A 1: 86,305,711 C109* probably null Het
C4b C A 17: 34,728,869 Q1657H probably damaging Het
Cadm2 A T 16: 66,747,339 L268* probably null Het
Cep290 G A 10: 100,554,400 probably benign Het
Cep68 T G 11: 20,230,571 I687L probably benign Het
Chd6 T A 2: 161,052,688 D84V probably damaging Het
Clpx A G 9: 65,322,769 T514A probably benign Het
Cox18 A T 5: 90,215,028 C324S probably benign Het
Cryzl2 T C 1: 157,462,016 Y75H probably damaging Het
Cxcr6 C T 9: 123,810,951 A339V possibly damaging Het
Dock1 T C 7: 135,163,442 L1721P probably benign Het
Dstyk T C 1: 132,453,080 probably benign Het
Ehf A G 2: 103,266,870 Y246H probably damaging Het
Epas1 T C 17: 86,805,193 V73A probably benign Het
Filip1 A G 9: 79,818,310 I1009T possibly damaging Het
Glis3 A T 19: 28,298,768 probably benign Het
Gm17333 A T 16: 77,852,790 noncoding transcript Het
Gpc1 G A 1: 92,857,309 R358H possibly damaging Het
Gria1 A G 11: 57,186,027 D83G probably damaging Het
Grid2 A G 6: 64,666,052 I933V probably benign Het
Hhatl C T 9: 121,788,762 A254T probably benign Het
Hook2 A G 8: 84,993,567 probably benign Het
Ift140 T A 17: 25,050,340 S656R possibly damaging Het
Il11ra1 A T 4: 41,766,185 T241S probably benign Het
Kank1 A G 19: 25,411,242 I760V probably benign Het
Kansl1 T C 11: 104,424,132 E360G possibly damaging Het
Klf9 A T 19: 23,142,082 S110C probably damaging Het
Klhl31 A G 9: 77,650,653 N217S probably benign Het
Lct T C 1: 128,300,525 Y1077C probably damaging Het
Lrrc49 A T 9: 60,610,246 probably benign Het
Lrrn1 T A 6: 107,569,120 H626Q probably benign Het
Mmp28 A T 11: 83,451,732 L40Q probably damaging Het
Mroh1 C T 15: 76,452,099 A1530V probably benign Het
Myo1e A G 9: 70,301,793 probably benign Het
Naa25 A T 5: 121,435,490 M761L probably benign Het
Ncln G A 10: 81,488,297 A465V probably damaging Het
Nktr A G 9: 121,731,484 N98S probably damaging Het
Olfr1012 T C 2: 85,759,904 I157M possibly damaging Het
Olfr215 C A 6: 116,582,781 S55I probably benign Het
Olfr651 T A 7: 104,553,369 V150E probably benign Het
Olfr76 G C 19: 12,120,370 A114G possibly damaging Het
Olfr878 G T 9: 37,919,553 A304S possibly damaging Het
Pacsin2 T C 15: 83,386,782 Y222C probably damaging Het
Pcdhb15 C T 18: 37,474,168 T151M possibly damaging Het
Plcz1 C A 6: 140,023,230 V161L possibly damaging Het
Ppp6c G A 2: 39,200,124 probably benign Het
Rhbdf2 T A 11: 116,603,992 Y286F probably benign Het
Rtn3 A T 19: 7,457,876 D231E probably damaging Het
Slc35c2 A C 2: 165,280,895 Y156* probably null Het
Spata46 A G 1: 170,311,537 D35G probably damaging Het
Tmed3 A G 9: 89,702,873 F110L possibly damaging Het
Tmem104 T G 11: 115,201,308 probably benign Het
Tpbg T A 9: 85,844,938 V320E possibly damaging Het
Trib2 T C 12: 15,793,663 D190G probably damaging Het
Tspan2 A G 3: 102,759,385 T26A probably damaging Het
Usp17lb A C 7: 104,841,151 Y190D possibly damaging Het
Utp18 C T 11: 93,880,147 probably benign Het
Utp20 A T 10: 88,820,979 D121E probably damaging Het
Vmn1r80 T A 7: 12,193,317 M118K possibly damaging Het
Vmn1r84 T C 7: 12,361,867 S300G probably benign Het
Other mutations in Gpr155
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Gpr155 APN 2 73362613 missense probably damaging 1.00
IGL01432:Gpr155 APN 2 73351885 missense possibly damaging 0.51
IGL01528:Gpr155 APN 2 73362423 critical splice donor site probably null
IGL01718:Gpr155 APN 2 73382232 missense probably benign
IGL01733:Gpr155 APN 2 73353612 splice site probably null
IGL03342:Gpr155 APN 2 73349678 missense probably damaging 1.00
PIT1430001:Gpr155 UTSW 2 73370138 missense probably benign 0.08
PIT4810001:Gpr155 UTSW 2 73348263 missense probably benign 0.08
R0226:Gpr155 UTSW 2 73367592 missense probably benign 0.02
R0445:Gpr155 UTSW 2 73370144 splice site probably benign
R1570:Gpr155 UTSW 2 73370038 missense possibly damaging 0.87
R1598:Gpr155 UTSW 2 73370090 missense probably damaging 0.98
R1647:Gpr155 UTSW 2 73364164 splice site probably null
R1648:Gpr155 UTSW 2 73364164 splice site probably null
R1756:Gpr155 UTSW 2 73367577 missense probably benign 0.00
R1760:Gpr155 UTSW 2 73381935 missense probably damaging 1.00
R2033:Gpr155 UTSW 2 73348182 missense probably benign 0.18
R2044:Gpr155 UTSW 2 73373633 missense probably damaging 1.00
R2145:Gpr155 UTSW 2 73356658 missense probably benign 0.01
R2172:Gpr155 UTSW 2 73382127 missense probably benign 0.00
R2274:Gpr155 UTSW 2 73348135 critical splice donor site probably null
R3878:Gpr155 UTSW 2 73368392 nonsense probably null
R3924:Gpr155 UTSW 2 73370076 missense probably damaging 1.00
R4910:Gpr155 UTSW 2 73367538 nonsense probably null
R4950:Gpr155 UTSW 2 73382185 missense probably benign
R5337:Gpr155 UTSW 2 73348248 missense probably benign 0.32
R5830:Gpr155 UTSW 2 73370089 missense possibly damaging 0.93
R5887:Gpr155 UTSW 2 73343718 nonsense probably null
R5929:Gpr155 UTSW 2 73373667 nonsense probably null
R6293:Gpr155 UTSW 2 73373997 missense possibly damaging 0.47
R6553:Gpr155 UTSW 2 73349645 missense probably damaging 1.00
R6585:Gpr155 UTSW 2 73349645 missense probably damaging 1.00
R7003:Gpr155 UTSW 2 73343617 missense probably damaging 0.99
R7353:Gpr155 UTSW 2 73367491 nonsense probably null
R7506:Gpr155 UTSW 2 73368339 missense probably damaging 0.97
R7631:Gpr155 UTSW 2 73382947 intron probably benign
R7753:Gpr155 UTSW 2 73382206 missense probably benign 0.27
R7810:Gpr155 UTSW 2 73381952 missense probably damaging 0.99
R7813:Gpr155 UTSW 2 73381985 nonsense probably null
R7815:Gpr155 UTSW 2 73362560 missense probably benign
R7873:Gpr155 UTSW 2 73343590 missense possibly damaging 0.51
R8506:Gpr155 UTSW 2 73343462 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTCAAAACTCCTGACTGGAAAGACAT -3'
(R):5'- GGGCCAACAGAGCATTCTCTTATAACA -3'

Sequencing Primer
(F):5'- CTGGAAAGACATACTCAGTCAATTAC -3'
(R):5'- CGGATAATGTGCCGGATTCC -3'
Posted On2014-04-29