Incidental Mutation 'R0360:Ccdc73'
ID 177857
Institutional Source Beutler Lab
Gene Symbol Ccdc73
Ensembl Gene ENSMUSG00000045106
Gene Name coiled-coil domain containing 73
Synonyms 2210415I11Rik
MMRRC Submission 038566-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # R0360 (G1)
Quality Score 42
Status Validated
Chromosome 2
Chromosomal Location 104716669-104830082 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 104811352 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 310 (N310K)
Ref Sequence ENSEMBL: ENSMUSP00000120706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111114] [ENSMUST00000151764]
AlphaFold Q8CDM4
Predicted Effect probably damaging
Transcript: ENSMUST00000111114
AA Change: N320K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106743
Gene: ENSMUSG00000045106
AA Change: N320K

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:CCDC73 27 1061 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000151764
AA Change: N310K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120706
Gene: ENSMUSG00000045106
AA Change: N310K

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
coiled coil region 48 134 N/A INTRINSIC
coiled coil region 178 381 N/A INTRINSIC
Meta Mutation Damage Score 0.0792 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency 98% (93/95)
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 G A 7: 28,310,553 (GRCm39) probably benign Het
Adcyap1r1 G T 6: 55,452,508 (GRCm39) probably benign Het
Ankrd6 T C 4: 32,836,424 (GRCm39) T44A probably damaging Het
Ano7 A G 1: 93,316,380 (GRCm39) D221G probably benign Het
Bhlhe40 C A 6: 108,641,711 (GRCm39) N218K probably damaging Het
Bms1 A G 6: 118,382,251 (GRCm39) V429A probably benign Het
C7 T A 15: 5,018,444 (GRCm39) T800S probably benign Het
Camta2 G A 11: 70,574,136 (GRCm39) T127I probably damaging Het
Ccdc13 T A 9: 121,627,282 (GRCm39) N665I probably damaging Het
Ccdc157 T C 11: 4,096,663 (GRCm39) E362G probably damaging Het
Cfap91 T A 16: 38,118,659 (GRCm39) probably null Het
Cmklr1 A T 5: 113,752,578 (GRCm39) L141H probably damaging Het
Cnst C A 1: 179,407,100 (GRCm39) A49E probably benign Het
Col5a3 C T 9: 20,683,762 (GRCm39) R1498Q unknown Het
Crybb3 T A 5: 113,223,819 (GRCm39) I197F probably damaging Het
Cryzl1 G A 16: 91,504,155 (GRCm39) P97S probably benign Het
Cubn T C 2: 13,315,318 (GRCm39) probably benign Het
Cyp2d37-ps T C 15: 82,574,253 (GRCm39) noncoding transcript Het
Cyp4a12b C A 4: 115,290,117 (GRCm39) N223K probably benign Het
D16Ertd472e A T 16: 78,344,773 (GRCm39) C112S probably benign Het
Dennd2a T C 6: 39,485,233 (GRCm39) T349A probably benign Het
Dock5 G A 14: 68,060,129 (GRCm39) probably benign Het
Dpp6 T C 5: 27,857,267 (GRCm39) L404P probably damaging Het
Dsc3 T A 18: 20,104,639 (GRCm39) T563S possibly damaging Het
Dync2h1 T A 9: 7,113,182 (GRCm39) E214D possibly damaging Het
Elac2 A G 11: 64,870,136 (GRCm39) Y67C probably damaging Het
Elmo1 A T 13: 20,748,663 (GRCm39) K503* probably null Het
Eng T C 2: 32,569,149 (GRCm39) S559P probably benign Het
Epc2 T A 2: 49,427,145 (GRCm39) V563E possibly damaging Het
Fancm A G 12: 65,122,724 (GRCm39) Y82C probably damaging Het
Flt4 A T 11: 49,527,818 (GRCm39) M924L probably benign Het
Gabpa T A 16: 84,654,275 (GRCm39) N317K possibly damaging Het
Gchfr T G 2: 118,998,327 (GRCm39) Y3* probably null Het
Gli3 G T 13: 15,899,349 (GRCm39) G912V probably benign Het
Gm10295 C A 7: 71,000,361 (GRCm39) C73F unknown Het
Gm10382 G T 5: 125,466,728 (GRCm39) probably benign Het
Gp1ba T C 11: 70,531,284 (GRCm39) probably benign Het
Gpr146 G A 5: 139,364,933 (GRCm39) probably benign Het
Hexd T A 11: 121,102,969 (GRCm39) H62Q probably benign Het
Hgd T A 16: 37,431,546 (GRCm39) probably benign Het
Hs6st1 G A 1: 36,108,266 (GRCm39) probably null Het
Icam4 A G 9: 20,941,117 (GRCm39) Y123C probably damaging Het
Il24 A G 1: 130,811,674 (GRCm39) V134A probably damaging Het
Iqcb1 G T 16: 36,692,670 (GRCm39) A562S probably damaging Het
Iqgap2 A C 13: 95,867,783 (GRCm39) probably benign Het
Islr2 T C 9: 58,107,027 (GRCm39) T78A possibly damaging Het
Kif1b A G 4: 149,347,186 (GRCm39) I330T probably damaging Het
Kirrel1 T C 3: 86,997,106 (GRCm39) Y287C probably damaging Het
Klf10 C T 15: 38,297,090 (GRCm39) V317M probably benign Het
Klhl9 T G 4: 88,638,527 (GRCm39) K571N probably benign Het
Lin37 T C 7: 30,256,438 (GRCm39) I97V possibly damaging Het
Lrrc37a C T 11: 103,391,466 (GRCm39) V1320I possibly damaging Het
Lrrc74a A G 12: 86,784,569 (GRCm39) H99R probably damaging Het
Me3 T A 7: 89,435,622 (GRCm39) probably null Het
Med13 T C 11: 86,219,987 (GRCm39) probably benign Het
Myh6 A T 14: 55,185,804 (GRCm39) Y1490* probably null Het
Myo10 T C 15: 25,804,454 (GRCm39) L1583P probably damaging Het
Nkx6-3 A G 8: 23,647,722 (GRCm39) E227G possibly damaging Het
Nlrp1a T A 11: 71,004,830 (GRCm39) probably benign Het
Nlrp5-ps A C 7: 14,317,016 (GRCm39) noncoding transcript Het
Nup188 T G 2: 30,216,491 (GRCm39) I765S probably null Het
Obscn G A 11: 59,019,107 (GRCm39) A969V probably benign Het
Or11a4 T C 17: 37,536,934 (GRCm39) L306P possibly damaging Het
Or1j19 T A 2: 36,677,452 (GRCm39) M305K probably benign Het
Or5a1 G T 19: 12,097,217 (GRCm39) D286E possibly damaging Het
Or8k33 A T 2: 86,384,123 (GRCm39) L115Q probably damaging Het
Otogl T A 10: 107,606,511 (GRCm39) probably benign Het
Pcnx3 G A 19: 5,715,611 (GRCm39) R1472W probably damaging Het
Plekha5 G A 6: 140,537,473 (GRCm39) R646K possibly damaging Het
Plscr4 T A 9: 92,370,814 (GRCm39) probably benign Het
Pon2 G A 6: 5,266,156 (GRCm39) Q288* probably null Het
Ptpn13 C A 5: 103,681,214 (GRCm39) R805S probably damaging Het
Pyroxd2 A T 19: 42,735,992 (GRCm39) V62D probably damaging Het
Rab37 G T 11: 115,047,790 (GRCm39) C44F probably damaging Het
Rbm44 T C 1: 91,080,069 (GRCm39) S52P probably benign Het
Rgl3 A G 9: 21,888,153 (GRCm39) W454R probably damaging Het
Rita1 A G 5: 120,747,837 (GRCm39) S154P probably benign Het
Scn5a T C 9: 119,351,665 (GRCm39) D772G probably damaging Het
Sec23ip G A 7: 128,363,129 (GRCm39) probably benign Het
Skic8 A T 9: 54,634,862 (GRCm39) probably benign Het
Slc23a1 T A 18: 35,756,032 (GRCm39) probably benign Het
Slco1a8 A C 6: 141,928,053 (GRCm39) probably benign Het
Sparcl1 T A 5: 104,237,503 (GRCm39) D444V probably damaging Het
Taar6 C A 10: 23,861,046 (GRCm39) V167L probably benign Het
Tmcc3 T A 10: 94,414,407 (GRCm39) N36K probably benign Het
Tmem200c T A 17: 69,147,543 (GRCm39) V42E probably damaging Het
Trhde T C 10: 114,338,887 (GRCm39) probably benign Het
Tshz3 A G 7: 36,469,958 (GRCm39) E649G probably benign Het
Utp4 T C 8: 107,625,169 (GRCm39) probably benign Het
Vmn1r30 A G 6: 58,412,262 (GRCm39) V190A probably benign Het
Vmn1r35 A G 6: 66,655,827 (GRCm39) I281T probably damaging Het
Vmn1r58 G T 7: 5,413,329 (GRCm39) H300Q probably benign Het
Vmn1r84 A G 7: 12,095,799 (GRCm39) L286P probably damaging Het
Vmn2r54 A T 7: 12,349,576 (GRCm39) C669S probably damaging Het
Zfp623 T C 15: 75,820,510 (GRCm39) S489P probably benign Het
Other mutations in Ccdc73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Ccdc73 APN 2 104,824,936 (GRCm39) missense probably damaging 1.00
IGL01313:Ccdc73 APN 2 104,737,972 (GRCm39) missense probably benign 0.00
IGL02016:Ccdc73 APN 2 104,805,961 (GRCm39) missense probably benign 0.05
IGL02179:Ccdc73 APN 2 104,737,913 (GRCm39) missense probably damaging 0.99
FR4304:Ccdc73 UTSW 2 104,822,185 (GRCm39) unclassified probably benign
FR4737:Ccdc73 UTSW 2 104,822,185 (GRCm39) unclassified probably benign
IGL03052:Ccdc73 UTSW 2 104,782,281 (GRCm39) missense possibly damaging 0.78
R0010:Ccdc73 UTSW 2 104,811,332 (GRCm39) splice site probably benign
R0040:Ccdc73 UTSW 2 104,822,429 (GRCm39) missense probably damaging 1.00
R0052:Ccdc73 UTSW 2 104,759,915 (GRCm39) splice site probably benign
R0401:Ccdc73 UTSW 2 104,821,634 (GRCm39) missense probably benign 0.01
R0715:Ccdc73 UTSW 2 104,803,499 (GRCm39) splice site probably benign
R0839:Ccdc73 UTSW 2 104,821,442 (GRCm39) missense probably benign 0.05
R1129:Ccdc73 UTSW 2 104,822,535 (GRCm39) missense possibly damaging 0.51
R1240:Ccdc73 UTSW 2 104,821,906 (GRCm39) missense probably benign 0.05
R1478:Ccdc73 UTSW 2 104,745,012 (GRCm39) missense possibly damaging 0.93
R1478:Ccdc73 UTSW 2 104,737,955 (GRCm39) missense possibly damaging 0.72
R1695:Ccdc73 UTSW 2 104,822,450 (GRCm39) missense probably damaging 1.00
R1924:Ccdc73 UTSW 2 104,822,637 (GRCm39) missense probably damaging 1.00
R1950:Ccdc73 UTSW 2 104,757,280 (GRCm39) missense probably benign 0.01
R1987:Ccdc73 UTSW 2 104,829,504 (GRCm39) missense probably damaging 1.00
R1987:Ccdc73 UTSW 2 104,761,390 (GRCm39) nonsense probably null
R2938:Ccdc73 UTSW 2 104,805,980 (GRCm39) nonsense probably null
R3420:Ccdc73 UTSW 2 104,782,293 (GRCm39) splice site probably null
R3420:Ccdc73 UTSW 2 104,782,292 (GRCm39) missense probably null 1.00
R3422:Ccdc73 UTSW 2 104,782,293 (GRCm39) splice site probably null
R3422:Ccdc73 UTSW 2 104,782,292 (GRCm39) missense probably null 1.00
R3522:Ccdc73 UTSW 2 104,821,830 (GRCm39) missense probably damaging 1.00
R3886:Ccdc73 UTSW 2 104,821,688 (GRCm39) missense possibly damaging 0.94
R4279:Ccdc73 UTSW 2 104,815,355 (GRCm39) missense possibly damaging 0.87
R4791:Ccdc73 UTSW 2 104,811,450 (GRCm39) splice site probably null
R4793:Ccdc73 UTSW 2 104,848,127 (GRCm39) splice site probably null
R4939:Ccdc73 UTSW 2 104,822,502 (GRCm39) splice site probably null
R4950:Ccdc73 UTSW 2 104,822,711 (GRCm39) missense probably benign
R5093:Ccdc73 UTSW 2 104,848,111 (GRCm39) utr 3 prime probably benign
R5150:Ccdc73 UTSW 2 104,822,384 (GRCm39) missense probably benign 0.00
R5381:Ccdc73 UTSW 2 104,820,270 (GRCm39) missense probably damaging 1.00
R5738:Ccdc73 UTSW 2 104,761,331 (GRCm39) missense possibly damaging 0.78
R6148:Ccdc73 UTSW 2 104,822,482 (GRCm39) missense possibly damaging 0.58
R6269:Ccdc73 UTSW 2 104,737,978 (GRCm39) missense probably damaging 1.00
R6738:Ccdc73 UTSW 2 104,822,433 (GRCm39) missense probably benign 0.00
R6753:Ccdc73 UTSW 2 104,821,869 (GRCm39) nonsense probably null
R7062:Ccdc73 UTSW 2 104,782,223 (GRCm39) missense probably damaging 1.00
R7110:Ccdc73 UTSW 2 104,803,569 (GRCm39) missense probably benign 0.21
R7320:Ccdc73 UTSW 2 104,829,521 (GRCm39) missense possibly damaging 0.47
R7436:Ccdc73 UTSW 2 104,782,214 (GRCm39) missense probably damaging 1.00
R7530:Ccdc73 UTSW 2 104,824,915 (GRCm39) missense
R7747:Ccdc73 UTSW 2 104,759,901 (GRCm39) missense probably damaging 1.00
R7952:Ccdc73 UTSW 2 104,775,801 (GRCm39) critical splice donor site probably null
R8178:Ccdc73 UTSW 2 104,821,557 (GRCm39) missense probably benign 0.00
R8824:Ccdc73 UTSW 2 104,822,222 (GRCm39) missense possibly damaging 0.74
R8927:Ccdc73 UTSW 2 104,822,542 (GRCm39) missense
R8928:Ccdc73 UTSW 2 104,822,542 (GRCm39) missense
R8945:Ccdc73 UTSW 2 104,821,712 (GRCm39) missense probably benign 0.03
R9365:Ccdc73 UTSW 2 104,738,011 (GRCm39) missense probably damaging 1.00
Z1177:Ccdc73 UTSW 2 104,822,584 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTGGATCATGCTACAGTCATGCTT -3'
(R):5'- GGGCTTTGCTCACCTGCCAT -3'

Sequencing Primer
(F):5'- AGCTAAACTCTAAGCACCTTTCTG -3'
(R):5'- CTCACTTTGGGGGAAATATGATTGC -3'
Posted On 2014-04-30