Incidental Mutation 'R0409:Disp3'
ID177862
Institutional Source Beutler Lab
Gene Symbol Disp3
Ensembl Gene ENSMUSG00000041544
Gene Namedispatched RND transporter family member 3
SynonymsPtchd2, G630052C06Rik
MMRRC Submission 038611-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0409 (G1)
Quality Score75
Status Validated
Chromosome4
Chromosomal Location148240264-148287965 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 148271959 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 148 (E148A)
Ref Sequence ENSEMBL: ENSMUSP00000038490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047720]
Predicted Effect probably damaging
Transcript: ENSMUST00000047720
AA Change: E148A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038490
Gene: ENSMUSG00000041544
AA Change: E148A

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
low complexity region 159 171 N/A INTRINSIC
low complexity region 179 195 N/A INTRINSIC
Pfam:Patched 362 735 2.2e-21 PFAM
Pfam:MMPL 366 590 3.1e-14 PFAM
Pfam:Sterol-sensing 435 588 1.1e-17 PFAM
Pfam:Patched 1121 1301 1.6e-7 PFAM
transmembrane domain 1314 1333 N/A INTRINSIC
Meta Mutation Damage Score 0.0759 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A C 4: 42,972,203 K512T probably damaging Het
1700113H08Rik G T 10: 87,225,954 A89S probably damaging Het
4933417A18Rik A T 13: 34,924,549 I5L probably benign Het
Alkbh3 T A 2: 94,001,448 I146F possibly damaging Het
Aox2 A T 1: 58,336,624 I871F possibly damaging Het
Birc2 A C 9: 7,819,384 V509G possibly damaging Het
Car7 G A 8: 104,548,424 A165T probably damaging Het
Ccdc81 A G 7: 89,886,215 V271A probably benign Het
Cdc40 G T 10: 40,847,168 H302N probably damaging Het
Cep104 C T 4: 153,983,053 probably benign Het
Cfap54 C A 10: 92,776,213 S3161I probably benign Het
Chil5 A G 3: 106,034,966 probably benign Het
Chil6 C T 3: 106,404,176 G96D probably benign Het
Cnot1 T C 8: 95,748,855 K531E probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Eps8l2 A G 7: 141,342,980 Y52C probably damaging Het
Exph5 C A 9: 53,374,343 T908K probably benign Het
Fat4 C T 3: 38,977,413 S2449F probably damaging Het
Faxc T A 4: 21,948,751 N154K probably benign Het
Fbxo43 C T 15: 36,162,357 A235T probably benign Het
Fnip1 A G 11: 54,480,354 probably null Het
Fsd1l T C 4: 53,679,932 L210P probably benign Het
Gm6420 A C 1: 23,256,038 S123R unknown Het
Gm8801 T G 17: 35,947,376 noncoding transcript Het
Gmfb T C 14: 46,816,222 I36V probably benign Het
Gsap G A 5: 21,222,445 probably benign Het
Hectd1 T A 12: 51,782,556 I969L possibly damaging Het
Il21r G T 7: 125,629,840 probably benign Het
Lrrc7 A G 3: 158,161,426 F893L possibly damaging Het
Map2 A G 1: 66,433,580 I1715V probably damaging Het
Mlh3 A G 12: 85,240,854 I1339T possibly damaging Het
Nacad T C 11: 6,599,810 D1127G probably benign Het
Noc3l A G 19: 38,817,927 probably benign Het
Nup93 A G 8: 94,303,665 D384G probably damaging Het
Olfr1036 T A 2: 86,075,302 C187* probably null Het
Olfr474 T C 7: 107,955,226 I195T probably benign Het
Olfr889 C T 9: 38,116,251 L152F probably benign Het
Pls1 A T 9: 95,786,919 probably benign Het
Prkcb A T 7: 122,424,977 H75L probably damaging Het
Rev1 A T 1: 38,074,368 Y539* probably null Het
Rnf10 A T 5: 115,255,447 probably benign Het
Rnpepl1 A G 1: 92,915,860 Y234C probably damaging Het
Sdk2 T C 11: 113,850,891 probably benign Het
Sec23b T A 2: 144,567,912 M240K probably benign Het
Sema5a A T 15: 32,681,609 N945Y probably damaging Het
Snapc4 C A 2: 26,367,216 R799L probably benign Het
Tctn3 T C 19: 40,611,416 probably benign Het
Tfpt G A 7: 3,620,899 Q50* probably null Het
Trim80 T C 11: 115,441,213 V77A probably damaging Het
Trp73 T A 4: 154,064,384 D256V possibly damaging Het
Utrn G T 10: 12,643,601 N2202K probably benign Het
Vps13c T A 9: 67,951,644 F2792Y probably benign Het
Other mutations in Disp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Disp3 APN 4 148241534 missense probably benign 0.10
IGL01065:Disp3 APN 4 148261183 missense probably damaging 1.00
IGL01800:Disp3 APN 4 148249801 nonsense probably null
IGL01947:Disp3 APN 4 148260519 missense probably damaging 1.00
IGL02510:Disp3 APN 4 148252701 missense probably benign 0.00
IGL02573:Disp3 APN 4 148271449 missense probably damaging 1.00
IGL02728:Disp3 APN 4 148272038 missense probably damaging 1.00
IGL02931:Disp3 APN 4 148249201 missense possibly damaging 0.94
R0164:Disp3 UTSW 4 148254251 missense probably damaging 0.96
R0164:Disp3 UTSW 4 148254251 missense probably damaging 0.96
R0257:Disp3 UTSW 4 148250754 missense possibly damaging 0.87
R0557:Disp3 UTSW 4 148241404 missense possibly damaging 0.64
R0576:Disp3 UTSW 4 148241590 missense possibly damaging 0.89
R1495:Disp3 UTSW 4 148249825 missense probably benign 0.00
R1526:Disp3 UTSW 4 148259916 missense probably benign 0.00
R1791:Disp3 UTSW 4 148241518 missense probably damaging 1.00
R1856:Disp3 UTSW 4 148271632 missense probably damaging 1.00
R1987:Disp3 UTSW 4 148258753 missense probably damaging 0.97
R2030:Disp3 UTSW 4 148259966 missense probably damaging 1.00
R2271:Disp3 UTSW 4 148271602 missense possibly damaging 0.87
R2373:Disp3 UTSW 4 148258795 missense probably damaging 1.00
R2566:Disp3 UTSW 4 148241423 missense probably damaging 1.00
R3731:Disp3 UTSW 4 148252827 missense probably benign 0.03
R4359:Disp3 UTSW 4 148271932 missense probably benign 0.03
R4762:Disp3 UTSW 4 148272118 missense probably damaging 1.00
R4950:Disp3 UTSW 4 148258126 missense possibly damaging 0.94
R4975:Disp3 UTSW 4 148244216 missense possibly damaging 0.79
R5218:Disp3 UTSW 4 148242876 missense possibly damaging 0.88
R5523:Disp3 UTSW 4 148258097 missense probably benign 0.14
R5556:Disp3 UTSW 4 148258157 missense probably benign 0.14
R5857:Disp3 UTSW 4 148249183 missense probably benign 0.01
R5933:Disp3 UTSW 4 148241313 nonsense probably null
R5994:Disp3 UTSW 4 148254284 missense possibly damaging 0.94
R6362:Disp3 UTSW 4 148254308 missense possibly damaging 0.95
R6813:Disp3 UTSW 4 148259930 missense probably benign 0.09
R7211:Disp3 UTSW 4 148241522 missense probably damaging 0.98
R7470:Disp3 UTSW 4 148261070 missense possibly damaging 0.88
R7535:Disp3 UTSW 4 148242866 missense probably damaging 0.99
R8093:Disp3 UTSW 4 148270516 missense possibly damaging 0.93
R8357:Disp3 UTSW 4 148261115 missense possibly damaging 0.86
R8457:Disp3 UTSW 4 148261115 missense possibly damaging 0.86
R8506:Disp3 UTSW 4 148241570 missense possibly damaging 0.77
Z1088:Disp3 UTSW 4 148271743 missense possibly damaging 0.63
Z1176:Disp3 UTSW 4 148250957 missense probably damaging 1.00
Z1177:Disp3 UTSW 4 148249746 missense probably damaging 1.00
Z1177:Disp3 UTSW 4 148249847 missense probably benign 0.01
Z1177:Disp3 UTSW 4 148250714 missense probably damaging 1.00
Z1177:Disp3 UTSW 4 148270567 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTAGACGCTCGCTCGTGAAAATG -3'
(R):5'- CAACGCCTTTGAGATCCGCAAC -3'

Sequencing Primer
(F):5'- CGTGAAAATGTTGCGCTCC -3'
(R):5'- TTGAGATCCGCAACCACGAG -3'
Posted On2014-04-30