Incidental Mutation 'R0018:Cyp2b13'
ID177875
Institutional Source Beutler Lab
Gene Symbol Cyp2b13
Ensembl Gene ENSMUSG00000040583
Gene Namecytochrome P450, family 2, subfamily b, polypeptide 13
Synonymsphenobarbital inducible, type c
MMRRC Submission 038313-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0018 (G1)
Quality Score41
Status Validated
Chromosome7
Chromosomal Location26061497-26096197 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 26085950 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 248 (R248H)
Ref Sequence ENSEMBL: ENSMUSP00000005669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005669]
Predicted Effect probably benign
Transcript: ENSMUST00000005669
AA Change: R248H

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000005669
Gene: ENSMUSG00000040583
AA Change: R248H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:p450 31 488 9.8e-150 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T A 1: 93,154,605 D264V probably benign Het
Abca17 T C 17: 24,313,188 probably null Het
Afp A C 5: 90,506,741 Q546P probably damaging Het
Api5 A T 2: 94,420,984 probably null Het
Atp2b4 T A 1: 133,717,871 I982F probably damaging Het
BC024139 G A 15: 76,120,887 Q592* probably null Het
Capn7 T A 14: 31,354,112 C290* probably null Het
Celsr1 T A 15: 86,031,042 D910V possibly damaging Het
Chga T C 12: 102,558,505 S45P probably damaging Het
Cpne2 T A 8: 94,556,053 C59S possibly damaging Het
Cyr61 A G 3: 145,649,431 L23P probably damaging Het
Dennd1a T A 2: 37,858,460 T336S possibly damaging Het
Drc7 A G 8: 95,074,234 Y628C probably damaging Het
Dse A G 10: 34,153,468 V542A probably benign Het
Dspp A T 5: 104,178,230 S820C unknown Het
Eif5b T C 1: 38,018,889 S91P unknown Het
Epop A G 11: 97,628,191 V364A probably benign Het
Ext2 G A 2: 93,795,692 P341L probably damaging Het
Galns T C 8: 122,584,985 T429A probably benign Het
Gm11639 G A 11: 104,721,552 probably null Het
Gsx2 A G 5: 75,077,167 K260R probably damaging Het
H2-M10.6 A C 17: 36,814,049 H286P probably damaging Het
Hectd4 A G 5: 121,254,179 N169D possibly damaging Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Hmcn1 T C 1: 150,652,551 D3282G probably benign Het
Hnmt T A 2: 24,003,628 N285Y possibly damaging Het
Hr A G 14: 70,558,277 R450G probably benign Het
Kat6a A G 8: 22,929,273 D684G possibly damaging Het
Kif27 T G 13: 58,288,053 I1309L probably benign Het
Man2b1 T A 8: 85,097,489 V1005E probably damaging Het
Me2 A T 18: 73,791,852 F265I possibly damaging Het
Myo9a A T 9: 59,871,724 T1588S probably benign Het
Neu4 T A 1: 94,025,338 D476E probably benign Het
Nlrp9c T A 7: 26,371,998 Q895L possibly damaging Het
Olfr395 T C 11: 73,906,626 I289V probably damaging Het
Olfr406 A C 11: 74,270,108 T240P probably benign Het
Pdzd8 C T 19: 59,300,673 R765H probably damaging Het
Plk1 T C 7: 122,168,985 probably null Het
Ppfia2 A G 10: 106,842,786 probably benign Het
Prkdc T C 16: 15,726,542 Y1799H probably benign Het
Psmc1 T C 12: 100,116,692 probably benign Het
Ptchd3 A C 11: 121,842,344 I687L probably benign Het
Ptprh A G 7: 4,601,846 probably null Het
Pus3 A G 9: 35,566,624 D384G probably benign Het
Rab44 C T 17: 29,139,380 P181S probably benign Het
Rasa2 A G 9: 96,571,963 S307P probably damaging Het
Rbpms2 A G 9: 65,651,078 D142G probably damaging Het
Reln A T 5: 21,925,371 D2647E probably benign Het
Ryr2 G A 13: 11,595,223 T4239I possibly damaging Het
Sctr C A 1: 120,043,556 probably benign Het
Serpinb6e A T 13: 33,837,845 Y167N probably damaging Het
Slc13a5 T C 11: 72,266,475 I31V probably benign Het
Slc15a4 A T 5: 127,602,010 I422N probably damaging Het
Stk24 G A 14: 121,308,007 probably benign Het
Vmn1r213 T A 13: 23,012,141 V298D probably damaging Het
Xdh C T 17: 73,925,025 R230H probably benign Het
Zfp418 A T 7: 7,182,450 S471C probably benign Het
Other mutations in Cyp2b13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Cyp2b13 APN 7 26081727 missense probably benign 0.26
IGL01134:Cyp2b13 APN 7 26081700 missense probably damaging 1.00
IGL02386:Cyp2b13 APN 7 26086013 missense probably damaging 1.00
IGL02531:Cyp2b13 APN 7 26061605 missense possibly damaging 0.55
IGL02960:Cyp2b13 APN 7 26061676 missense probably benign 0.33
R0018:Cyp2b13 UTSW 7 26085950 missense probably benign 0.30
R0103:Cyp2b13 UTSW 7 26088710 missense probably damaging 1.00
R0121:Cyp2b13 UTSW 7 26086585 missense probably benign
R0392:Cyp2b13 UTSW 7 26085883 missense probably benign 0.01
R0540:Cyp2b13 UTSW 7 26081711 missense probably benign 0.07
R1887:Cyp2b13 UTSW 7 26088650 missense probably damaging 1.00
R2416:Cyp2b13 UTSW 7 26095821 makesense probably null
R2879:Cyp2b13 UTSW 7 26086031 critical splice donor site probably null
R4654:Cyp2b13 UTSW 7 26061647 missense probably damaging 1.00
R4735:Cyp2b13 UTSW 7 26088295 missense probably benign
R4969:Cyp2b13 UTSW 7 26080988 missense probably damaging 0.98
R5174:Cyp2b13 UTSW 7 26088693 missense possibly damaging 0.68
R6243:Cyp2b13 UTSW 7 26061619 missense probably damaging 1.00
R6616:Cyp2b13 UTSW 7 26085881 missense probably benign 0.04
R6647:Cyp2b13 UTSW 7 26085899 missense possibly damaging 0.52
R6766:Cyp2b13 UTSW 7 26081811 critical splice donor site probably null
R6844:Cyp2b13 UTSW 7 26081697 missense probably damaging 1.00
R7431:Cyp2b13 UTSW 7 26061551 missense probably damaging 0.96
R7593:Cyp2b13 UTSW 7 26080991 missense possibly damaging 0.64
R7719:Cyp2b13 UTSW 7 26095670 missense probably damaging 1.00
R7857:Cyp2b13 UTSW 7 26088728 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTGGAACCTGATAGCTCCAGGTGA -3'
(R):5'- CAGAGAGTGGTGCTGGTAGTCTCA -3'

Sequencing Primer
(F):5'- TGATAGCTCCAGGTGACCTCC -3'
(R):5'- ttcttctctcttctctttctctctac -3'
Posted On2014-04-30