Incidental Mutation 'R0018:Man2b1'
ID177877
Institutional Source Beutler Lab
Gene Symbol Man2b1
Ensembl Gene ENSMUSG00000005142
Gene Namemannosidase 2, alpha B1
Synonymslysosomal alpha-mannosidase
MMRRC Submission 038313-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0018 (G1)
Quality Score65
Status Validated
Chromosome8
Chromosomal Location85083270-85098282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85097489 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1005 (V1005E)
Ref Sequence ENSEMBL: ENSMUSP00000034121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034121]
Predicted Effect probably damaging
Transcript: ENSMUST00000034121
AA Change: V1005E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034121
Gene: ENSMUSG00000005142
AA Change: V1005E

DomainStartEndE-ValueType
low complexity region 40 51 N/A INTRINSIC
Pfam:Glyco_hydro_38 64 381 2.7e-96 PFAM
Alpha-mann_mid 386 465 4.25e-23 SMART
Pfam:Glyco_hydro_38C 510 1002 6.2e-106 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that hydrolyzes terminal, non-reducing alpha-D-mannose residues in alpha-D-mannosides. Its activity is necessary for the catabolism of N-linked carbohydrates released during glycoprotein turnover and it is member of family 38 of glycosyl hydrolases. The full length protein is processed in two steps. First, a 49 aa leader sequence is cleaved off and the remainder of the protein is processed into 3 peptides of 70 kDa, 42 kDa (D) and 13/15 kDa (E). Next, the 70 kDa peptide is further processed into three peptides (A, B and C). The A, B and C peptides are disulfide-linked. Defects in this gene have been associated with lysosomal alpha-mannosidosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show urinary oligosaccharide excretion, storage of neutral sugars, oligosaccharide buildup in spleen, kidney, liver, testis and brain, clear vacuoles and axonal spheroids in CNS, PNS and other cell types, behavioralchanges, and enhanced long-term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T A 1: 93,154,605 D264V probably benign Het
Abca17 T C 17: 24,313,188 probably null Het
Afp A C 5: 90,506,741 Q546P probably damaging Het
Api5 A T 2: 94,420,984 probably null Het
Atp2b4 T A 1: 133,717,871 I982F probably damaging Het
BC024139 G A 15: 76,120,887 Q592* probably null Het
Capn7 T A 14: 31,354,112 C290* probably null Het
Celsr1 T A 15: 86,031,042 D910V possibly damaging Het
Chga T C 12: 102,558,505 S45P probably damaging Het
Cpne2 T A 8: 94,556,053 C59S possibly damaging Het
Cyp2b13 G A 7: 26,085,950 R248H probably benign Het
Cyr61 A G 3: 145,649,431 L23P probably damaging Het
Dennd1a T A 2: 37,858,460 T336S possibly damaging Het
Drc7 A G 8: 95,074,234 Y628C probably damaging Het
Dse A G 10: 34,153,468 V542A probably benign Het
Dspp A T 5: 104,178,230 S820C unknown Het
Eif5b T C 1: 38,018,889 S91P unknown Het
Epop A G 11: 97,628,191 V364A probably benign Het
Ext2 G A 2: 93,795,692 P341L probably damaging Het
Galns T C 8: 122,584,985 T429A probably benign Het
Gm11639 G A 11: 104,721,552 probably null Het
Gsx2 A G 5: 75,077,167 K260R probably damaging Het
H2-M10.6 A C 17: 36,814,049 H286P probably damaging Het
Hectd4 A G 5: 121,254,179 N169D possibly damaging Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Hmcn1 T C 1: 150,652,551 D3282G probably benign Het
Hnmt T A 2: 24,003,628 N285Y possibly damaging Het
Hr A G 14: 70,558,277 R450G probably benign Het
Kat6a A G 8: 22,929,273 D684G possibly damaging Het
Kif27 T G 13: 58,288,053 I1309L probably benign Het
Me2 A T 18: 73,791,852 F265I possibly damaging Het
Myo9a A T 9: 59,871,724 T1588S probably benign Het
Neu4 T A 1: 94,025,338 D476E probably benign Het
Nlrp9c T A 7: 26,371,998 Q895L possibly damaging Het
Olfr395 T C 11: 73,906,626 I289V probably damaging Het
Olfr406 A C 11: 74,270,108 T240P probably benign Het
Pdzd8 C T 19: 59,300,673 R765H probably damaging Het
Plk1 T C 7: 122,168,985 probably null Het
Ppfia2 A G 10: 106,842,786 probably benign Het
Prkdc T C 16: 15,726,542 Y1799H probably benign Het
Psmc1 T C 12: 100,116,692 probably benign Het
Ptchd3 A C 11: 121,842,344 I687L probably benign Het
Ptprh A G 7: 4,601,846 probably null Het
Pus3 A G 9: 35,566,624 D384G probably benign Het
Rab44 C T 17: 29,139,380 P181S probably benign Het
Rasa2 A G 9: 96,571,963 S307P probably damaging Het
Rbpms2 A G 9: 65,651,078 D142G probably damaging Het
Reln A T 5: 21,925,371 D2647E probably benign Het
Ryr2 G A 13: 11,595,223 T4239I possibly damaging Het
Sctr C A 1: 120,043,556 probably benign Het
Serpinb6e A T 13: 33,837,845 Y167N probably damaging Het
Slc13a5 T C 11: 72,266,475 I31V probably benign Het
Slc15a4 A T 5: 127,602,010 I422N probably damaging Het
Stk24 G A 14: 121,308,007 probably benign Het
Vmn1r213 T A 13: 23,012,141 V298D probably damaging Het
Xdh C T 17: 73,925,025 R230H probably benign Het
Zfp418 A T 7: 7,182,450 S471C probably benign Het
Other mutations in Man2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Man2b1 APN 8 85084638 splice site probably null
IGL00671:Man2b1 APN 8 85093938 missense probably damaging 0.98
IGL01538:Man2b1 APN 8 85097430 missense probably benign 0.00
dateline UTSW 8 85084737 missense probably damaging 1.00
meridian UTSW 8 85096752 missense probably damaging 1.00
R0302:Man2b1 UTSW 8 85093016 missense probably damaging 1.00
R0574:Man2b1 UTSW 8 85096776 missense probably benign
R0727:Man2b1 UTSW 8 85091526 missense probably damaging 1.00
R0837:Man2b1 UTSW 8 85096829 missense possibly damaging 0.92
R1087:Man2b1 UTSW 8 85095171 missense probably damaging 1.00
R1471:Man2b1 UTSW 8 85086845 missense probably damaging 0.99
R1745:Man2b1 UTSW 8 85093934 missense probably damaging 1.00
R1903:Man2b1 UTSW 8 85086822 missense probably damaging 1.00
R2026:Man2b1 UTSW 8 85095335 missense probably damaging 0.99
R2071:Man2b1 UTSW 8 85085384 missense possibly damaging 0.90
R2120:Man2b1 UTSW 8 85093024 splice site probably benign
R3897:Man2b1 UTSW 8 85096948 splice site probably benign
R3971:Man2b1 UTSW 8 85085391 missense probably damaging 0.98
R3972:Man2b1 UTSW 8 85085391 missense probably damaging 0.98
R4096:Man2b1 UTSW 8 85084737 missense probably damaging 1.00
R4497:Man2b1 UTSW 8 85090936 missense probably benign 0.22
R5183:Man2b1 UTSW 8 85095784 missense probably damaging 1.00
R5191:Man2b1 UTSW 8 85084459 missense probably damaging 1.00
R5644:Man2b1 UTSW 8 85094210 missense possibly damaging 0.61
R6027:Man2b1 UTSW 8 85096752 missense probably damaging 1.00
R6291:Man2b1 UTSW 8 85097046 missense probably benign 0.44
R6341:Man2b1 UTSW 8 85095399 missense probably damaging 1.00
R6467:Man2b1 UTSW 8 85097447 missense possibly damaging 0.91
R6622:Man2b1 UTSW 8 85084479 missense probably damaging 1.00
R6624:Man2b1 UTSW 8 85096853 missense probably benign 0.01
R6631:Man2b1 UTSW 8 85086811 unclassified probably null
R6828:Man2b1 UTSW 8 85086919 missense possibly damaging 0.88
R6983:Man2b1 UTSW 8 85091071 splice site probably null
R7159:Man2b1 UTSW 8 85087280 missense probably benign 0.09
R7267:Man2b1 UTSW 8 85087175 missense probably damaging 1.00
R7537:Man2b1 UTSW 8 85090965 nonsense probably null
R7786:Man2b1 UTSW 8 85085456 nonsense probably null
R8022:Man2b1 UTSW 8 85095613 missense probably damaging 1.00
R8069:Man2b1 UTSW 8 85097045 missense probably benign 0.03
Z1176:Man2b1 UTSW 8 85093938 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CATCAGTGTCTGGTTCAAGGATGGC -3'
(R):5'- ACCCAGGGTGCAACAGGTTTTC -3'

Sequencing Primer
(F):5'- AATCTTAGGTGGTACTCAGGCATAG -3'
(R):5'- GTGCAACAGGTTTTCTGATACC -3'
Posted On2014-04-30