Incidental Mutation 'R0018:Slc13a5'
ID177882
Institutional Source Beutler Lab
Gene Symbol Slc13a5
Ensembl Gene ENSMUSG00000020805
Gene Namesolute carrier family 13 (sodium-dependent citrate transporter), member 5
SynonymsIndy, Nact, mINDY, NaC2/NaCT
MMRRC Submission 038313-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0018 (G1)
Quality Score70
Status Validated
Chromosome11
Chromosomal Location72241989-72267222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72266475 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 31 (I31V)
Ref Sequence ENSEMBL: ENSMUSP00000146762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021161] [ENSMUST00000137701] [ENSMUST00000140167] [ENSMUST00000208056] [ENSMUST00000208912]
Predicted Effect probably benign
Transcript: ENSMUST00000021161
AA Change: I31V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021161
Gene: ENSMUSG00000020805
AA Change: I31V

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 8 558 1.3e-121 PFAM
Pfam:CitMHS 13 172 1.6e-14 PFAM
Pfam:CitMHS 202 498 6.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137701
AA Change: I31V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119417
Gene: ENSMUSG00000020805
AA Change: I31V

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 7 115 1.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140167
AA Change: I31V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119822
Gene: ENSMUSG00000020805
AA Change: I31V

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 6 102 7.9e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147937
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154739
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207990
Predicted Effect probably benign
Transcript: ENSMUST00000208056
AA Change: I31V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000208912
AA Change: I31V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the solute carrier family 13 group of proteins. This family member is a sodium-dependent citrate cotransporter that may regulate metabolic processes. Mutations in this gene cause early infantile epileptic encephalopathy 25. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a null allele display resistance to diet and age induced obesity, increased energy expenditure, improved glucose tolerance, and increased hepatic lipid oxidation. Mice homozygous for an ENU-induced allele exhibit reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T A 1: 93,154,605 D264V probably benign Het
Abca17 T C 17: 24,313,188 probably null Het
Afp A C 5: 90,506,741 Q546P probably damaging Het
Api5 A T 2: 94,420,984 probably null Het
Atp2b4 T A 1: 133,717,871 I982F probably damaging Het
BC024139 G A 15: 76,120,887 Q592* probably null Het
Capn7 T A 14: 31,354,112 C290* probably null Het
Celsr1 T A 15: 86,031,042 D910V possibly damaging Het
Chga T C 12: 102,558,505 S45P probably damaging Het
Cpne2 T A 8: 94,556,053 C59S possibly damaging Het
Cyp2b13 G A 7: 26,085,950 R248H probably benign Het
Cyr61 A G 3: 145,649,431 L23P probably damaging Het
Dennd1a T A 2: 37,858,460 T336S possibly damaging Het
Drc7 A G 8: 95,074,234 Y628C probably damaging Het
Dse A G 10: 34,153,468 V542A probably benign Het
Dspp A T 5: 104,178,230 S820C unknown Het
Eif5b T C 1: 38,018,889 S91P unknown Het
Epop A G 11: 97,628,191 V364A probably benign Het
Ext2 G A 2: 93,795,692 P341L probably damaging Het
Galns T C 8: 122,584,985 T429A probably benign Het
Gm11639 G A 11: 104,721,552 probably null Het
Gsx2 A G 5: 75,077,167 K260R probably damaging Het
H2-M10.6 A C 17: 36,814,049 H286P probably damaging Het
Hectd4 A G 5: 121,254,179 N169D possibly damaging Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Hmcn1 T C 1: 150,652,551 D3282G probably benign Het
Hnmt T A 2: 24,003,628 N285Y possibly damaging Het
Hr A G 14: 70,558,277 R450G probably benign Het
Kat6a A G 8: 22,929,273 D684G possibly damaging Het
Kif27 T G 13: 58,288,053 I1309L probably benign Het
Man2b1 T A 8: 85,097,489 V1005E probably damaging Het
Me2 A T 18: 73,791,852 F265I possibly damaging Het
Myo9a A T 9: 59,871,724 T1588S probably benign Het
Neu4 T A 1: 94,025,338 D476E probably benign Het
Nlrp9c T A 7: 26,371,998 Q895L possibly damaging Het
Olfr395 T C 11: 73,906,626 I289V probably damaging Het
Olfr406 A C 11: 74,270,108 T240P probably benign Het
Pdzd8 C T 19: 59,300,673 R765H probably damaging Het
Plk1 T C 7: 122,168,985 probably null Het
Ppfia2 A G 10: 106,842,786 probably benign Het
Prkdc T C 16: 15,726,542 Y1799H probably benign Het
Psmc1 T C 12: 100,116,692 probably benign Het
Ptchd3 A C 11: 121,842,344 I687L probably benign Het
Ptprh A G 7: 4,601,846 probably null Het
Pus3 A G 9: 35,566,624 D384G probably benign Het
Rab44 C T 17: 29,139,380 P181S probably benign Het
Rasa2 A G 9: 96,571,963 S307P probably damaging Het
Rbpms2 A G 9: 65,651,078 D142G probably damaging Het
Reln A T 5: 21,925,371 D2647E probably benign Het
Ryr2 G A 13: 11,595,223 T4239I possibly damaging Het
Sctr C A 1: 120,043,556 probably benign Het
Serpinb6e A T 13: 33,837,845 Y167N probably damaging Het
Slc15a4 A T 5: 127,602,010 I422N probably damaging Het
Stk24 G A 14: 121,308,007 probably benign Het
Vmn1r213 T A 13: 23,012,141 V298D probably damaging Het
Xdh C T 17: 73,925,025 R230H probably benign Het
Zfp418 A T 7: 7,182,450 S471C probably benign Het
Other mutations in Slc13a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02347:Slc13a5 APN 11 72258954 splice site probably null
IGL03392:Slc13a5 APN 11 72245178 missense probably damaging 1.00
Punk UTSW 11 72262076 missense probably damaging 1.00
punk2 UTSW 11 72253391 missense possibly damaging 0.65
R0018:Slc13a5 UTSW 11 72266475 missense probably benign
R0042:Slc13a5 UTSW 11 72259114 missense probably benign 0.31
R0194:Slc13a5 UTSW 11 72245233 missense probably benign 0.22
R0194:Slc13a5 UTSW 11 72262130 missense possibly damaging 0.95
R0234:Slc13a5 UTSW 11 72250800 missense probably damaging 0.98
R1499:Slc13a5 UTSW 11 72250731 missense probably damaging 0.97
R1655:Slc13a5 UTSW 11 72257378 missense probably benign 0.00
R1728:Slc13a5 UTSW 11 72266459 splice site probably null
R1818:Slc13a5 UTSW 11 72253343 missense probably benign 0.02
R2304:Slc13a5 UTSW 11 72259039 missense probably damaging 1.00
R2352:Slc13a5 UTSW 11 72252321 missense probably benign 0.06
R2408:Slc13a5 UTSW 11 72262076 missense probably damaging 1.00
R2919:Slc13a5 UTSW 11 72247791 missense possibly damaging 0.92
R2920:Slc13a5 UTSW 11 72247791 missense possibly damaging 0.92
R3103:Slc13a5 UTSW 11 72257388 missense probably damaging 1.00
R4772:Slc13a5 UTSW 11 72250846 critical splice acceptor site probably null
R4906:Slc13a5 UTSW 11 72257418 missense probably damaging 0.99
R5385:Slc13a5 UTSW 11 72259077 missense probably benign 0.01
R5562:Slc13a5 UTSW 11 72262039 missense probably damaging 0.99
R5878:Slc13a5 UTSW 11 72253391 missense possibly damaging 0.65
R6173:Slc13a5 UTSW 11 72253197 missense probably benign 0.05
R6665:Slc13a5 UTSW 11 72260360 missense probably damaging 0.99
R7317:Slc13a5 UTSW 11 72245127 missense probably damaging 1.00
R7338:Slc13a5 UTSW 11 72266484 missense probably benign
R7908:Slc13a5 UTSW 11 72259064 missense probably benign 0.00
R8038:Slc13a5 UTSW 11 72253370 missense probably benign 0.31
R8420:Slc13a5 UTSW 11 72257384 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCCAGCCTTCAGAGTCTCTAC -3'
(R):5'- AAGCTTCTAGCTGCCTCGCAATC -3'

Sequencing Primer
(F):5'- AGTCAGAGGCTAAGCCTGTC -3'
(R):5'- AGCTGCCTCGCAATCTTTTC -3'
Posted On2014-04-30