Incidental Mutation 'R0024:Grid2ip'
ID177904
Institutional Source Beutler Lab
Gene Symbol Grid2ip
Ensembl Gene ENSMUSG00000010825
Gene Nameglutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1
Synonymsdelphilin
MMRRC Submission 038319-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R0024 (G1)
Quality Score61
Status Validated
Chromosome5
Chromosomal Location143357338-143392152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 143391041 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 947 (S947T)
Ref Sequence ENSEMBL: ENSMUSP00000010969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010969] [ENSMUST00000110733] [ENSMUST00000120825]
Predicted Effect probably damaging
Transcript: ENSMUST00000010969
AA Change: S947T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000010969
Gene: ENSMUSG00000010825
AA Change: S947T

DomainStartEndE-ValueType
low complexity region 30 55 N/A INTRINSIC
low complexity region 57 73 N/A INTRINSIC
low complexity region 78 92 N/A INTRINSIC
PDZ 97 166 9.5e-16 SMART
low complexity region 256 272 N/A INTRINSIC
low complexity region 284 304 N/A INTRINSIC
low complexity region 429 446 N/A INTRINSIC
low complexity region 464 478 N/A INTRINSIC
low complexity region 536 584 N/A INTRINSIC
low complexity region 607 625 N/A INTRINSIC
FH2 633 1022 1.39e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110733
AA Change: S1126T

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000106361
Gene: ENSMUSG00000010825
AA Change: S1126T

DomainStartEndE-ValueType
PDZ 10 80 1.13e-13 SMART
low complexity region 98 109 N/A INTRINSIC
low complexity region 209 234 N/A INTRINSIC
low complexity region 236 252 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
PDZ 276 345 9.5e-16 SMART
low complexity region 435 451 N/A INTRINSIC
low complexity region 463 483 N/A INTRINSIC
low complexity region 608 625 N/A INTRINSIC
low complexity region 643 657 N/A INTRINSIC
low complexity region 715 763 N/A INTRINSIC
low complexity region 786 804 N/A INTRINSIC
FH2 812 1201 1.39e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120825
AA Change: S954T

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113443
Gene: ENSMUSG00000010825
AA Change: S954T

DomainStartEndE-ValueType
low complexity region 37 62 N/A INTRINSIC
low complexity region 64 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
PDZ 104 173 9.5e-16 SMART
low complexity region 263 279 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
low complexity region 436 453 N/A INTRINSIC
low complexity region 471 485 N/A INTRINSIC
low complexity region 543 591 N/A INTRINSIC
low complexity region 614 632 N/A INTRINSIC
FH2 640 1029 1.39e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198312
Meta Mutation Damage Score 0.1246 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glutamate receptor delta-2 (GRID2; MIM 602368) is predominantly expressed at parallel fiber-Purkinje cell postsynapses and plays crucial roles in synaptogenesis and synaptic plasticity. GRID2IP1 interacts with GRID2 and may control GRID2 signaling in Purkinje cells (Matsuda et al., 2006 [PubMed 16835239]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display facilitated long-term depression induction at parallel fiber-Purkinje cell synapses as well as enhanced optokinetic response adaptation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,433,385 D209V probably damaging Het
Bbx T A 16: 50,224,918 M427L probably benign Het
Btbd11 A G 10: 85,387,447 D40G unknown Het
Camk2d A G 3: 126,797,723 M281V probably benign Het
Chdh G A 14: 30,031,596 R154H possibly damaging Het
Emid1 A T 11: 5,143,869 W93R probably damaging Het
Gstt4 T A 10: 75,817,204 M175L possibly damaging Het
Hectd4 C T 5: 121,308,576 T242I possibly damaging Het
Hfm1 T C 5: 106,856,924 K1179E probably benign Het
Kif13b A G 14: 64,750,273 I750V probably benign Het
Krt34 A T 11: 100,041,037 C119S probably benign Het
Krt6a A G 15: 101,690,715 probably benign Het
Myof G T 19: 37,915,740 T4N probably damaging Het
Olfr457 A G 6: 42,471,260 M306T probably benign Het
P3h3 T C 6: 124,857,458 Q77R probably benign Het
Picalm T C 7: 90,130,704 probably null Het
Plcb1 A G 2: 135,362,425 S900G probably benign Het
Prkd2 T C 7: 16,847,643 L141P probably damaging Het
Prpf31 C A 7: 3,636,659 probably null Het
Rgs5 T A 1: 169,676,892 V37D probably damaging Het
Slc24a2 T C 4: 87,028,240 probably benign Het
Ssh2 A T 11: 77,454,966 Q1259L possibly damaging Het
Sugct G A 13: 16,857,869 H433Y probably benign Het
Sycp2l A G 13: 41,141,788 I310M probably damaging Het
Utrn A G 10: 12,406,011 V3301A probably benign Het
Other mutations in Grid2ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02271:Grid2ip APN 5 143388909 missense probably benign
IGL02894:Grid2ip APN 5 143391108 missense probably benign 0.04
R0355:Grid2ip UTSW 5 143357897 missense probably benign 0.10
R0403:Grid2ip UTSW 5 143357620 missense possibly damaging 0.84
R0523:Grid2ip UTSW 5 143373043 missense possibly damaging 0.85
R0605:Grid2ip UTSW 5 143379362 missense probably damaging 0.99
R0664:Grid2ip UTSW 5 143363977 critical splice donor site probably null
R1116:Grid2ip UTSW 5 143382914 missense possibly damaging 0.96
R1251:Grid2ip UTSW 5 143386015 missense possibly damaging 0.69
R1381:Grid2ip UTSW 5 143362651 missense probably benign 0.00
R1384:Grid2ip UTSW 5 143386096 critical splice donor site probably null
R1477:Grid2ip UTSW 5 143375585 missense probably damaging 1.00
R2266:Grid2ip UTSW 5 143386092 missense probably benign 0.01
R2267:Grid2ip UTSW 5 143386092 missense probably benign 0.01
R2304:Grid2ip UTSW 5 143387840 missense probably damaging 1.00
R2871:Grid2ip UTSW 5 143357929 missense probably benign
R2871:Grid2ip UTSW 5 143357929 missense probably benign
R2873:Grid2ip UTSW 5 143357929 missense probably benign
R2874:Grid2ip UTSW 5 143357929 missense probably benign
R3196:Grid2ip UTSW 5 143388178 missense probably damaging 0.99
R3622:Grid2ip UTSW 5 143386019 missense probably damaging 1.00
R3930:Grid2ip UTSW 5 143386039 missense probably damaging 1.00
R4628:Grid2ip UTSW 5 143382875 missense probably damaging 1.00
R4696:Grid2ip UTSW 5 143391376 intron probably benign
R4709:Grid2ip UTSW 5 143388903 missense probably damaging 1.00
R4772:Grid2ip UTSW 5 143375700 missense possibly damaging 0.91
R4838:Grid2ip UTSW 5 143388775 nonsense probably null
R4857:Grid2ip UTSW 5 143382629 missense probably damaging 1.00
R5243:Grid2ip UTSW 5 143377505 missense probably damaging 1.00
R5894:Grid2ip UTSW 5 143388911 missense probably damaging 1.00
R6014:Grid2ip UTSW 5 143387823 missense possibly damaging 0.84
R6076:Grid2ip UTSW 5 143387375 missense probably benign 0.17
R6209:Grid2ip UTSW 5 143380429 missense probably damaging 1.00
R6257:Grid2ip UTSW 5 143380429 missense probably damaging 1.00
R6274:Grid2ip UTSW 5 143380429 missense probably damaging 1.00
R6439:Grid2ip UTSW 5 143373502 missense probably damaging 0.99
R7098:Grid2ip UTSW 5 143357591 missense probably damaging 0.97
R7405:Grid2ip UTSW 5 143380444 missense probably benign 0.03
R7652:Grid2ip UTSW 5 143382638 missense probably damaging 1.00
X0010:Grid2ip UTSW 5 143357878 missense probably benign 0.01
X0012:Grid2ip UTSW 5 143362639 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAGCCAAGGTCAGTCCAAGTGAAC -3'
(R):5'- ATCCCACCAGAGACAGGAGATGTG -3'

Sequencing Primer
(F):5'- aggtgggggtggggaag -3'
(R):5'- GAGATGTGCCACCCACTG -3'
Posted On2014-04-30