Incidental Mutation 'R0024:Picalm'
ID177907
Institutional Source Beutler Lab
Gene Symbol Picalm
Ensembl Gene ENSMUSG00000039361
Gene Namephosphatidylinositol binding clathrin assembly protein
Synonymsfit-1, fit1
MMRRC Submission 038319-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.919) question?
Stock #R0024 (G1)
Quality Score53
Status Validated
Chromosome7
Chromosomal Location90130213-90213465 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 90130704 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049537] [ENSMUST00000049537] [ENSMUST00000207225] [ENSMUST00000207225] [ENSMUST00000207484] [ENSMUST00000207484] [ENSMUST00000208684] [ENSMUST00000208730] [ENSMUST00000208730] [ENSMUST00000208742] [ENSMUST00000208742] [ENSMUST00000209068] [ENSMUST00000209068]
Predicted Effect probably null
Transcript: ENSMUST00000049537
SMART Domains Protein: ENSMUSP00000051092
Gene: ENSMUSG00000039361

DomainStartEndE-ValueType
ENTH 20 145 2.42e-39 SMART
coiled coil region 317 349 N/A INTRINSIC
low complexity region 378 387 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000049537
SMART Domains Protein: ENSMUSP00000051092
Gene: ENSMUSG00000039361

DomainStartEndE-ValueType
ENTH 20 145 2.42e-39 SMART
coiled coil region 317 349 N/A INTRINSIC
low complexity region 378 387 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207197
Predicted Effect probably null
Transcript: ENSMUST00000207225
Predicted Effect probably null
Transcript: ENSMUST00000207225
Predicted Effect probably null
Transcript: ENSMUST00000207484
Predicted Effect probably null
Transcript: ENSMUST00000207484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207949
Predicted Effect probably benign
Transcript: ENSMUST00000208684
Predicted Effect probably null
Transcript: ENSMUST00000208730
Predicted Effect probably null
Transcript: ENSMUST00000208730
Predicted Effect probably null
Transcript: ENSMUST00000208742
Predicted Effect probably null
Transcript: ENSMUST00000208742
Predicted Effect probably null
Transcript: ENSMUST00000209068
Predicted Effect probably null
Transcript: ENSMUST00000209068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209166
Meta Mutation Damage Score 0.9501 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a clathrin assembly protein, which recruits clathrin and adaptor protein complex 2 (AP2) to cell membranes at sites of coated-pit formation and clathrin-vesicle assembly. The protein may be required to determine the amount of membrane to be recycled, possibly by regulating the size of the clathrin cage. The protein is involved in AP2-dependent clathrin-mediated endocytosis at the neuromuscular junction. A chromosomal translocation t(10;11)(p13;q14) leading to the fusion of this gene and the MLLT10 gene is found in acute lymphoblastic leukemia, acute myeloid leukemia and malignant lymphomas. The polymorphisms of this gene are associated with the risk of Alzheimer disease. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for different ENU-induced mutations or knock-out alleles are small, runted and display anemia of variable severity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,433,385 D209V probably damaging Het
Bbx T A 16: 50,224,918 M427L probably benign Het
Btbd11 A G 10: 85,387,447 D40G unknown Het
Camk2d A G 3: 126,797,723 M281V probably benign Het
Chdh G A 14: 30,031,596 R154H possibly damaging Het
Emid1 A T 11: 5,143,869 W93R probably damaging Het
Grid2ip T A 5: 143,391,041 S947T probably damaging Het
Gstt4 T A 10: 75,817,204 M175L possibly damaging Het
Hectd4 C T 5: 121,308,576 T242I possibly damaging Het
Hfm1 T C 5: 106,856,924 K1179E probably benign Het
Kif13b A G 14: 64,750,273 I750V probably benign Het
Krt34 A T 11: 100,041,037 C119S probably benign Het
Krt6a A G 15: 101,690,715 probably benign Het
Myof G T 19: 37,915,740 T4N probably damaging Het
Olfr457 A G 6: 42,471,260 M306T probably benign Het
P3h3 T C 6: 124,857,458 Q77R probably benign Het
Plcb1 A G 2: 135,362,425 S900G probably benign Het
Prkd2 T C 7: 16,847,643 L141P probably damaging Het
Prpf31 C A 7: 3,636,659 probably null Het
Rgs5 T A 1: 169,676,892 V37D probably damaging Het
Slc24a2 T C 4: 87,028,240 probably benign Het
Ssh2 A T 11: 77,454,966 Q1259L possibly damaging Het
Sugct G A 13: 16,857,869 H433Y probably benign Het
Sycp2l A G 13: 41,141,788 I310M probably damaging Het
Utrn A G 10: 12,406,011 V3301A probably benign Het
Other mutations in Picalm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Picalm APN 7 90161318 missense probably damaging 1.00
IGL01147:Picalm APN 7 90177592 missense probably benign 0.42
IGL02814:Picalm APN 7 90191749 missense possibly damaging 0.75
IGL02828:Picalm APN 7 90177501 missense probably benign
IGL02904:Picalm APN 7 90176411 splice site probably benign
IGL02986:Picalm APN 7 90207585 missense probably benign 0.00
IGL03001:Picalm APN 7 90182246 missense probably benign 0.00
IGL03247:Picalm APN 7 90194291 missense probably benign 0.27
R0085:Picalm UTSW 7 90182317 missense probably benign
R0414:Picalm UTSW 7 90189198 missense possibly damaging 0.94
R0537:Picalm UTSW 7 90130668 missense probably benign 0.05
R0855:Picalm UTSW 7 90191148 missense possibly damaging 0.55
R1269:Picalm UTSW 7 90165549 nonsense probably null
R1496:Picalm UTSW 7 90130651 missense probably benign 0.36
R1635:Picalm UTSW 7 90191251 missense probably damaging 1.00
R1750:Picalm UTSW 7 90191182 missense possibly damaging 0.81
R1755:Picalm UTSW 7 90160549 missense possibly damaging 0.88
R2513:Picalm UTSW 7 90197009 missense probably damaging 1.00
R3850:Picalm UTSW 7 90191704 missense probably damaging 1.00
R3874:Picalm UTSW 7 90189219 missense probably damaging 1.00
R5095:Picalm UTSW 7 90170633 missense probably damaging 1.00
R5368:Picalm UTSW 7 90207595 makesense probably null
R5517:Picalm UTSW 7 90170598 missense possibly damaging 0.68
R6012:Picalm UTSW 7 90195700 missense probably benign
R6280:Picalm UTSW 7 90177562 missense probably benign 0.00
R6739:Picalm UTSW 7 90176708 missense probably damaging 1.00
R6951:Picalm UTSW 7 90191375 missense probably damaging 1.00
R7083:Picalm UTSW 7 90176768 missense probably benign 0.01
R7877:Picalm UTSW 7 90130668 missense probably benign 0.05
R8081:Picalm UTSW 7 90191243 nonsense probably null
Z1176:Picalm UTSW 7 90196967 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGCTCCGAGGAGGAGCCTG -3'
(R):5'- GGGCGCAATGGATTGTCACATTTT -3'

Sequencing Primer
(F):5'- CCGACTTGGTGTGGGAGC -3'
(R):5'- CGCAATGGATTGTCACATTTTTTTTC -3'
Posted On2014-04-30