Mutagenetix > Incidental Mutation

Incidental Mutation 'R0024:Abca16'

177908

Institutional Source

Beutler Lab

Gene Symbol

Abca16

Ensembl Gene

ENSMUSG00000051900

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 16

Synonyms

MMRRC Submission

038319-MU

Accession Numbers

NCBI RefSeq: NM_001278943.1, NM_001278944.1; MGI:2388711

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0024 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

120409647-120544813 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 120433385 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 209 (D209V)

Ref Sequence

ENSEMBL: ENSMUSP00000112736 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056042] [ENSMUST00000120490]

AlphaFold

E9PWJ7

Predicted Effect

probably damaging
Transcript: ENSMUST00000056042
AA Change: D209V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000061094
Gene: ENSMUSG00000051900
AA Change: D209V

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	26	455	2.7e-23	PFAM
AAA	537	720	2.01e-7	SMART
Pfam:ABC2_membrane_3	898	1287	4.6e-25	PFAM
low complexity region	1325	1336	N/A	INTRINSIC
low complexity region	1342	1353	N/A	INTRINSIC
AAA	1378	1563	4.23e-6	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000120490
AA Change: D209V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112736
Gene: ENSMUSG00000051900
AA Change: D209V

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	25	456	2.4e-22	PFAM
AAA	538	721	2.01e-7	SMART
Pfam:ABC2_membrane_3	899	1288	1.1e-27	PFAM
low complexity region	1326	1337	N/A	INTRINSIC
low complexity region	1343	1354	N/A	INTRINSIC
AAA	1379	1564	4.23e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144122

SMART Domains

Protein: ENSMUSP00000114975
Gene: ENSMUSG00000051900

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	2	133	1e-16	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 95.9%

Validation Efficiency

98% (47/48)

Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock

Total: 25 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bbx	T	A	16: 50,224,918	M427L	probably benign	Het
Btbd11	A	G	10: 85,387,447	D40G	unknown	Het
Camk2d	A	G	3: 126,797,723	M281V	probably benign	Het
Chdh	G	A	14: 30,031,596	R154H	possibly damaging	Het
Emid1	A	T	11: 5,143,869	W93R	probably damaging	Het
Grid2ip	T	A	5: 143,391,041	S947T	probably damaging	Het
Gstt4	T	A	10: 75,817,204	M175L	possibly damaging	Het
Hectd4	C	T	5: 121,308,576	T242I	possibly damaging	Het
Hfm1	T	C	5: 106,856,924	K1179E	probably benign	Het
Kif13b	A	G	14: 64,750,273	I750V	probably benign	Het
Krt34	A	T	11: 100,041,037	C119S	probably benign	Het
Krt6a	A	G	15: 101,690,715		probably benign	Het
Myof	G	T	19: 37,915,740	T4N	probably damaging	Het
Olfr457	A	G	6: 42,471,260	M306T	probably benign	Het
P3h3	T	C	6: 124,857,458	Q77R	probably benign	Het
Picalm	T	C	7: 90,130,704		probably null	Het
Plcb1	A	G	2: 135,362,425	S900G	probably benign	Het
Prkd2	T	C	7: 16,847,643	L141P	probably damaging	Het
Prpf31	C	A	7: 3,636,659		probably null	Het
Rgs5	T	A	1: 169,676,892	V37D	probably damaging	Het
Slc24a2	T	C	4: 87,028,240		probably benign	Het
Ssh2	A	T	11: 77,454,966	Q1259L	possibly damaging	Het
Sugct	G	A	13: 16,857,869	H433Y	probably benign	Het
Sycp2l	A	G	13: 41,141,788	I310M	probably damaging	Het
Utrn	A	G	10: 12,406,011	V3301A	probably benign	Het

Other mutations in Abca16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Abca16	APN	7	120423759	missense	probably benign	0.08
IGL00590:Abca16	APN	7	120423815	missense	probably damaging	1.00
IGL01320:Abca16	APN	7	120439199	missense	probably damaging	1.00
IGL01322:Abca16	APN	7	120439199	missense	probably damaging	1.00
IGL01613:Abca16	APN	7	120541277	missense	probably benign	0.03
IGL01774:Abca16	APN	7	120477835	missense	probably damaging	1.00
IGL01774:Abca16	APN	7	120421801	splice site	probably benign
IGL01797:Abca16	APN	7	120514537	missense	probably benign	0.15
IGL02406:Abca16	APN	7	120540602	missense	probably damaging	1.00
IGL02437:Abca16	APN	7	120533729	missense	probably benign	0.00
IGL02541:Abca16	APN	7	120514658	missense	possibly damaging	0.91
IGL02576:Abca16	APN	7	120433455	missense	probably benign	0.05
IGL02578:Abca16	APN	7	120423956	critical splice donor site	probably null
IGL03156:Abca16	APN	7	120423851	missense	possibly damaging	0.69
IGL03381:Abca16	APN	7	120527818	missense	probably benign	0.12
PIT4802001:Abca16	UTSW	7	120540128	missense	probably benign	0.31
R0026:Abca16	UTSW	7	120477923	splice site	probably benign
R0026:Abca16	UTSW	7	120477923	splice site	probably benign
R0123:Abca16	UTSW	7	120540155	missense	probably damaging	1.00
R0134:Abca16	UTSW	7	120540155	missense	probably damaging	1.00
R0225:Abca16	UTSW	7	120540155	missense	probably damaging	1.00
R0346:Abca16	UTSW	7	120435932	missense	probably damaging	1.00
R0355:Abca16	UTSW	7	120423798	missense	possibly damaging	0.68
R0358:Abca16	UTSW	7	120544716	missense	probably benign	0.01
R0525:Abca16	UTSW	7	120465810	nonsense	probably null
R0617:Abca16	UTSW	7	120433611	splice site	probably benign
R0625:Abca16	UTSW	7	120435893	missense	probably damaging	1.00
R0835:Abca16	UTSW	7	120465784	missense	probably benign	0.42
R1445:Abca16	UTSW	7	120520033	missense	probably benign	0.41
R1535:Abca16	UTSW	7	120540705	missense	probably benign	0.30
R1567:Abca16	UTSW	7	120431129	missense	probably benign	0.08
R1694:Abca16	UTSW	7	120520084	missense	probably damaging	1.00
R1860:Abca16	UTSW	7	120534763	missense	probably benign	0.02
R1876:Abca16	UTSW	7	120433385	missense	probably damaging	1.00
R1913:Abca16	UTSW	7	120541240	missense	probably benign	0.04
R1940:Abca16	UTSW	7	120433609	splice site	probably benign
R2042:Abca16	UTSW	7	120544718	missense	probably benign
R2115:Abca16	UTSW	7	120540645	missense	probably damaging	1.00
R2122:Abca16	UTSW	7	120519961	missense	probably damaging	1.00
R2265:Abca16	UTSW	7	120431160	missense	probably benign	0.03
R2267:Abca16	UTSW	7	120431160	missense	probably benign	0.03
R2269:Abca16	UTSW	7	120431160	missense	probably benign	0.03
R2993:Abca16	UTSW	7	120535161	missense	probably damaging	1.00
R3055:Abca16	UTSW	7	120435851	missense	probably benign	0.05
R3956:Abca16	UTSW	7	120527752	missense	probably damaging	0.96
R4114:Abca16	UTSW	7	120527067	missense	probably benign	0.06
R4441:Abca16	UTSW	7	120527801	missense	probably benign	0.04
R4601:Abca16	UTSW	7	120436697	missense	probably damaging	0.98
R4706:Abca16	UTSW	7	120465765	missense	probably damaging	1.00
R4807:Abca16	UTSW	7	120540609	missense	probably damaging	1.00
R4824:Abca16	UTSW	7	120475479	missense	possibly damaging	0.86
R4937:Abca16	UTSW	7	120527086	missense	probably damaging	0.98
R5152:Abca16	UTSW	7	120540623	missense	probably benign	0.02
R5257:Abca16	UTSW	7	120436769	critical splice donor site	probably null
R5258:Abca16	UTSW	7	120436769	critical splice donor site	probably null
R5330:Abca16	UTSW	7	120503377	missense	probably benign	0.15
R5388:Abca16	UTSW	7	120540746	critical splice donor site	probably null
R5590:Abca16	UTSW	7	120544772	missense	probably damaging	0.98
R5810:Abca16	UTSW	7	120435932	missense	probably damaging	1.00
R6030:Abca16	UTSW	7	120533798	missense	probably benign
R6030:Abca16	UTSW	7	120533798	missense	probably benign
R6161:Abca16	UTSW	7	120540711	missense	probably damaging	1.00
R6313:Abca16	UTSW	7	120527121	missense	probably damaging	1.00
R6485:Abca16	UTSW	7	120427167	nonsense	probably null
R6527:Abca16	UTSW	7	120477772	missense	possibly damaging	0.95
R6772:Abca16	UTSW	7	120527053	missense	probably damaging	1.00
R6885:Abca16	UTSW	7	120520109	missense	probably benign	0.07
R6899:Abca16	UTSW	7	120527041	missense	probably damaging	1.00
R6941:Abca16	UTSW	7	120541147	missense	probably damaging	1.00
R6990:Abca16	UTSW	7	120527727	missense	probably benign	0.00
R7059:Abca16	UTSW	7	120421748	missense	probably benign	0.00
R7144:Abca16	UTSW	7	120433573	missense	possibly damaging	0.89
R7146:Abca16	UTSW	7	120527751	missense	possibly damaging	0.46
R7193:Abca16	UTSW	7	120427186	missense	probably damaging	1.00
R7308:Abca16	UTSW	7	120423770	missense	probably benign	0.01
R7449:Abca16	UTSW	7	120435908	missense	possibly damaging	0.95
R7571:Abca16	UTSW	7	120519988	missense	probably benign	0.11
R7617:Abca16	UTSW	7	120503471	nonsense	probably null
R7646:Abca16	UTSW	7	120514714	missense	probably benign	0.04
R7750:Abca16	UTSW	7	120514705	missense	probably benign	0.09
R7763:Abca16	UTSW	7	120514602	missense	probably damaging	1.00
R7840:Abca16	UTSW	7	120475466	missense	probably benign	0.00
R7946:Abca16	UTSW	7	120527175	missense	probably benign	0.01
R8018:Abca16	UTSW	7	120533643	missense	probably benign	0.04
R8170:Abca16	UTSW	7	120465782	missense	probably damaging	1.00
R8413:Abca16	UTSW	7	120423900	missense	probably benign	0.06
R8461:Abca16	UTSW	7	120436695	missense	possibly damaging	0.95
R8858:Abca16	UTSW	7	120453104	missense	probably benign
R8881:Abca16	UTSW	7	120475571	missense	probably benign	0.18
R9272:Abca16	UTSW	7	120477770	missense	probably benign	0.13
R9303:Abca16	UTSW	7	120527766	missense	probably benign	0.25
R9305:Abca16	UTSW	7	120527766	missense	probably benign	0.25
R9320:Abca16	UTSW	7	120540097	missense	probably damaging	0.98
R9413:Abca16	UTSW	7	120527199	missense	probably benign	0.01
R9512:Abca16	UTSW	7	120423740	missense	probably benign	0.01
R9559:Abca16	UTSW	7	120421796	critical splice donor site	probably null
R9615:Abca16	UTSW	7	120527181	missense	probably benign	0.01
R9641:Abca16	UTSW	7	120527085	missense	possibly damaging	0.52
R9643:Abca16	UTSW	7	120465800	missense	possibly damaging	0.96
R9674:Abca16	UTSW	7	120475445	critical splice acceptor site	probably null
R9714:Abca16	UTSW	7	120431160	missense	probably benign	0.01
R9799:Abca16	UTSW	7	120533775	missense	probably benign	0.00
R9800:Abca16	UTSW	7	120520060	missense	possibly damaging	0.68
RF020:Abca16	UTSW	7	120533657	missense	possibly damaging	0.90
X0066:Abca16	UTSW	7	120503386	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GCTCTCTTGATGAACTCATAGCTTGCC -3'
(R):5'- TTTCAAACACAATGGATCGCATGATGG -3'

Sequencing Primer
(F):5'- GAATCATAGGCATTTGAACTCTAGTC -3'
(R):5'- TGGATCGCATGATGGAAAGGAC -3'

Posted On

2014-04-30