Incidental Mutation 'R0024:Bbx'
ID177917
Institutional Source Beutler Lab
Gene Symbol Bbx
Ensembl Gene ENSMUSG00000022641
Gene Namebobby sox HMG box containing
Synonyms5730403O13Rik, 5530401J07Rik
MMRRC Submission 038319-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0024 (G1)
Quality Score38
Status Validated
Chromosome16
Chromosomal Location50191844-50432390 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50224918 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 427 (M427L)
Ref Sequence ENSEMBL: ENSMUSP00000119238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066037] [ENSMUST00000089399] [ENSMUST00000089404] [ENSMUST00000114477] [ENSMUST00000114488] [ENSMUST00000138166]
Predicted Effect probably benign
Transcript: ENSMUST00000066037
AA Change: M319L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066384
Gene: ENSMUSG00000022641
AA Change: M319L

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
Pfam:DUF2028 109 150 3.1e-22 PFAM
Pfam:DUF2028 140 214 4.4e-26 PFAM
low complexity region 216 230 N/A INTRINSIC
low complexity region 336 348 N/A INTRINSIC
low complexity region 415 432 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 561 566 N/A INTRINSIC
low complexity region 780 795 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089399
AA Change: M427L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000086821
Gene: ENSMUSG00000022641
AA Change: M427L

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
HMG 79 149 2.76e-15 SMART
Pfam:DUF2028 190 322 2.8e-64 PFAM
low complexity region 324 338 N/A INTRINSIC
low complexity region 444 456 N/A INTRINSIC
low complexity region 523 540 N/A INTRINSIC
low complexity region 636 647 N/A INTRINSIC
low complexity region 669 674 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089404
AA Change: M427L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000086826
Gene: ENSMUSG00000022641
AA Change: M427L

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
HMG 79 149 2.76e-15 SMART
Pfam:DUF2028 190 322 3.7e-64 PFAM
low complexity region 324 338 N/A INTRINSIC
low complexity region 444 456 N/A INTRINSIC
low complexity region 523 540 N/A INTRINSIC
low complexity region 636 647 N/A INTRINSIC
low complexity region 669 674 N/A INTRINSIC
low complexity region 838 853 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114477
SMART Domains Protein: ENSMUSP00000110121
Gene: ENSMUSG00000022641

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
HMG 79 149 2.76e-15 SMART
Pfam:DUF2028 190 322 6.8e-64 PFAM
low complexity region 324 338 N/A INTRINSIC
low complexity region 444 456 N/A INTRINSIC
low complexity region 523 540 N/A INTRINSIC
low complexity region 636 647 N/A INTRINSIC
low complexity region 669 674 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114488
AA Change: M427L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110132
Gene: ENSMUSG00000022641
AA Change: M427L

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
HMG 79 149 2.76e-15 SMART
Pfam:DUF2028 190 322 3.8e-64 PFAM
low complexity region 324 338 N/A INTRINSIC
low complexity region 444 456 N/A INTRINSIC
low complexity region 523 540 N/A INTRINSIC
low complexity region 636 647 N/A INTRINSIC
low complexity region 669 674 N/A INTRINSIC
low complexity region 723 734 N/A INTRINSIC
low complexity region 858 873 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131695
Predicted Effect probably benign
Transcript: ENSMUST00000138166
AA Change: M427L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119238
Gene: ENSMUSG00000022641
AA Change: M427L

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
HMG 79 149 2.76e-15 SMART
Pfam:DUF2028 190 335 9.2e-54 PFAM
low complexity region 444 456 N/A INTRINSIC
low complexity region 523 540 N/A INTRINSIC
low complexity region 636 647 N/A INTRINSIC
low complexity region 669 674 N/A INTRINSIC
low complexity region 723 734 N/A INTRINSIC
low complexity region 858 873 N/A INTRINSIC
Meta Mutation Damage Score 0.0577 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele show increased IgA level, abnormal tooth morphology, and a reduction in heart weight, lean body mass, body length, long bone length, bone mineral density, and bone strength. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,433,385 D209V probably damaging Het
Btbd11 A G 10: 85,387,447 D40G unknown Het
Camk2d A G 3: 126,797,723 M281V probably benign Het
Chdh G A 14: 30,031,596 R154H possibly damaging Het
Emid1 A T 11: 5,143,869 W93R probably damaging Het
Grid2ip T A 5: 143,391,041 S947T probably damaging Het
Gstt4 T A 10: 75,817,204 M175L possibly damaging Het
Hectd4 C T 5: 121,308,576 T242I possibly damaging Het
Hfm1 T C 5: 106,856,924 K1179E probably benign Het
Kif13b A G 14: 64,750,273 I750V probably benign Het
Krt34 A T 11: 100,041,037 C119S probably benign Het
Krt6a A G 15: 101,690,715 probably benign Het
Myof G T 19: 37,915,740 T4N probably damaging Het
Olfr457 A G 6: 42,471,260 M306T probably benign Het
P3h3 T C 6: 124,857,458 Q77R probably benign Het
Picalm T C 7: 90,130,704 probably null Het
Plcb1 A G 2: 135,362,425 S900G probably benign Het
Prkd2 T C 7: 16,847,643 L141P probably damaging Het
Prpf31 C A 7: 3,636,659 probably null Het
Rgs5 T A 1: 169,676,892 V37D probably damaging Het
Slc24a2 T C 4: 87,028,240 probably benign Het
Ssh2 A T 11: 77,454,966 Q1259L possibly damaging Het
Sugct G A 13: 16,857,869 H433Y probably benign Het
Sycp2l A G 13: 41,141,788 I310M probably damaging Het
Utrn A G 10: 12,406,011 V3301A probably benign Het
Other mutations in Bbx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01403:Bbx APN 16 50202513 missense probably benign 0.08
IGL01544:Bbx APN 16 50274777 nonsense probably null
IGL02073:Bbx APN 16 50202491 missense probably damaging 1.00
IGL02302:Bbx APN 16 50224915 missense probably damaging 1.00
IGL02566:Bbx APN 16 50223240 splice site probably benign
IGL02618:Bbx APN 16 50247798 missense probably damaging 1.00
IGL03187:Bbx APN 16 50274563 missense probably damaging 0.96
IGL03215:Bbx APN 16 50202572 missense probably damaging 1.00
IGL03295:Bbx APN 16 50224564 missense probably damaging 1.00
dalton UTSW 16 50210442 splice site probably null
PIT4378001:Bbx UTSW 16 50280473 nonsense probably null
R0024:Bbx UTSW 16 50224918 missense probably benign
R0071:Bbx UTSW 16 50280392 missense probably benign 0.32
R0071:Bbx UTSW 16 50280392 missense probably benign 0.32
R0143:Bbx UTSW 16 50280392 missense probably benign 0.32
R0144:Bbx UTSW 16 50280392 missense probably benign 0.32
R0374:Bbx UTSW 16 50280392 missense probably benign 0.32
R0532:Bbx UTSW 16 50266284 missense probably damaging 1.00
R0550:Bbx UTSW 16 50274533 splice site probably benign
R0762:Bbx UTSW 16 50225166 missense possibly damaging 0.94
R0881:Bbx UTSW 16 50220600 splice site probably benign
R1448:Bbx UTSW 16 50266270 nonsense probably null
R1916:Bbx UTSW 16 50266245 missense probably damaging 1.00
R1983:Bbx UTSW 16 50209117 missense possibly damaging 0.62
R2006:Bbx UTSW 16 50224395 missense possibly damaging 0.93
R2095:Bbx UTSW 16 50224689 missense possibly damaging 0.88
R2145:Bbx UTSW 16 50274544 splice site probably benign
R2475:Bbx UTSW 16 50220519 missense probably damaging 0.99
R2892:Bbx UTSW 16 50224741 missense probably damaging 1.00
R4130:Bbx UTSW 16 50224858 missense probably damaging 1.00
R4177:Bbx UTSW 16 50224858 missense probably damaging 1.00
R4486:Bbx UTSW 16 50200414 missense probably damaging 1.00
R4989:Bbx UTSW 16 50224738 missense probably damaging 1.00
R5005:Bbx UTSW 16 50266351 missense probably damaging 1.00
R5427:Bbx UTSW 16 50280497 missense probably benign
R5582:Bbx UTSW 16 50223356 missense probably damaging 1.00
R6063:Bbx UTSW 16 50251367 missense probably benign
R6216:Bbx UTSW 16 50251388 missense probably benign 0.00
R6246:Bbx UTSW 16 50224660 missense probably benign 0.04
R6618:Bbx UTSW 16 50266263 missense probably damaging 1.00
R6782:Bbx UTSW 16 50200565 missense probably benign 0.00
R7007:Bbx UTSW 16 50202488 missense possibly damaging 0.67
R7130:Bbx UTSW 16 50210442 splice site probably null
R7864:Bbx UTSW 16 50262434 missense probably damaging 0.99
R7947:Bbx UTSW 16 50262434 missense probably damaging 0.99
X0021:Bbx UTSW 16 50247805 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GAGTTTGTCAACACCCCAGTCTCC -3'
(R):5'- TTTGGGAAGTCAGCTAAGGGCAAC -3'

Sequencing Primer
(F):5'- TTGCCACAGCTTCGATGG -3'
(R):5'- TCTAAGGACTTAAGAGACATCGAAC -3'
Posted On2014-04-30