Incidental Mutation 'R0008:Pdzph1'
ID 177926
Institutional Source Beutler Lab
Gene Symbol Pdzph1
Ensembl Gene ENSMUSG00000024227
Gene Name PDZ and pleckstrin homology domains 1
Synonyms 2610034M16Rik
MMRRC Submission 038303-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R0008 (G1)
Quality Score 73
Status Validated
Chromosome 17
Chromosomal Location 59185803-59298344 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 59229756 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025064]
AlphaFold Q8BGR1
Predicted Effect probably benign
Transcript: ENSMUST00000025064
SMART Domains Protein: ENSMUSP00000025064
Gene: ENSMUSG00000024227

DomainStartEndE-ValueType
Blast:PDZ 780 844 6e-20 BLAST
PDZ 915 984 3.31e-15 SMART
PH 993 1096 9.4e-19 SMART
PH 1120 1218 2.83e-13 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 98% (109/111)
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 137,882,346 (GRCm39) K118R possibly damaging Het
Adtrp T C 13: 41,920,941 (GRCm39) T88A probably damaging Het
Afap1l1 A G 18: 61,889,976 (GRCm39) S87P probably benign Het
Ankrd27 A G 7: 35,303,125 (GRCm39) K196R probably benign Het
Apoe G A 7: 19,431,005 (GRCm39) T79M probably damaging Het
Arrdc3 T A 13: 81,032,011 (GRCm39) Y81* probably null Het
Arrdc3 T A 13: 81,039,194 (GRCm39) I75N probably damaging Het
Asah2 T A 19: 31,981,131 (GRCm39) K629* probably null Het
Ass1 A T 2: 31,404,831 (GRCm39) N371Y probably damaging Het
C130074G19Rik A G 1: 184,615,119 (GRCm39) S24P probably benign Het
C87436 A G 6: 86,423,265 (GRCm39) probably benign Het
Calcrl T C 2: 84,203,618 (GRCm39) D54G probably benign Het
Clcn2 T C 16: 20,529,140 (GRCm39) N367S probably null Het
Cnot1 G T 8: 96,487,969 (GRCm39) D562E probably damaging Het
Commd6 G A 14: 101,877,709 (GRCm39) probably benign Het
Cox6a2 G A 7: 127,805,212 (GRCm39) probably benign Het
Cp T A 3: 20,022,287 (GRCm39) Y230N probably damaging Het
Dclre1c T C 2: 3,439,032 (GRCm39) V64A probably damaging Het
Eng T C 2: 32,567,692 (GRCm39) V110A probably damaging Het
Esyt3 T C 9: 99,220,860 (GRCm39) I114M possibly damaging Het
Fam83h A T 15: 75,875,811 (GRCm39) Y509N probably damaging Het
Fat2 A T 11: 55,202,075 (GRCm39) L333H probably damaging Het
Fbxo21 A G 5: 118,146,078 (GRCm39) N567S possibly damaging Het
Fcsk T C 8: 111,610,865 (GRCm39) probably benign Het
Fn1 A T 1: 71,634,879 (GRCm39) L1964Q probably damaging Het
Gorasp1 G T 9: 119,757,312 (GRCm39) S353R possibly damaging Het
Grk2 C T 19: 4,337,262 (GRCm39) E646K probably damaging Het
Hoxc11 T C 15: 102,863,397 (GRCm39) V146A probably damaging Het
Igf2bp2 T C 16: 21,894,841 (GRCm39) T301A probably benign Het
Il11 T C 7: 4,776,658 (GRCm39) S111G probably benign Het
Ist1 A T 8: 110,403,418 (GRCm39) I273K probably benign Het
Kdm2b G A 5: 123,019,806 (GRCm39) S738L probably benign Het
Lrp2 T A 2: 69,346,895 (GRCm39) N784Y probably benign Het
Lrp6 T C 6: 134,462,716 (GRCm39) E648G probably damaging Het
Mapk15 G A 15: 75,870,103 (GRCm39) E408K probably benign Het
Mdn1 T A 4: 32,718,317 (GRCm39) F2191I possibly damaging Het
Metrn C A 17: 26,015,479 (GRCm39) V79F possibly damaging Het
Mtbp T A 15: 55,449,889 (GRCm39) probably benign Het
Myh11 C A 16: 14,041,883 (GRCm39) Q720H probably damaging Het
Myo3a T A 2: 22,469,753 (GRCm39) I508N probably damaging Het
Nat9 A T 11: 115,075,941 (GRCm39) Y27N probably damaging Het
Ncapg2 T C 12: 116,393,455 (GRCm39) F553S probably damaging Het
Nipsnap3b T A 4: 53,015,112 (GRCm39) L53Q probably damaging Het
Nlrp3 A T 11: 59,449,274 (GRCm39) H852L probably benign Het
Or2d3b A G 7: 106,514,226 (GRCm39) I274V probably benign Het
Or2t6 T A 14: 14,176,092 (GRCm38) probably benign Het
Or4a78 T A 2: 89,497,428 (GRCm39) K267N probably damaging Het
Or52e3 A T 7: 102,869,558 (GRCm39) D211V probably damaging Het
Or52e3 G A 7: 102,869,584 (GRCm39) A220T probably benign Het
Or5b122 A G 19: 13,563,240 (GRCm39) I191V probably benign Het
Pax9 A G 12: 56,756,528 (GRCm39) T289A probably benign Het
Pcyt2 A T 11: 120,506,695 (GRCm39) I53N possibly damaging Het
Pdlim4 C T 11: 53,945,875 (GRCm39) V327M probably damaging Het
Plekhm2 C T 4: 141,369,704 (GRCm39) probably benign Het
Ppt1 T C 4: 122,742,216 (GRCm39) probably benign Het
Prdm1 C T 10: 44,317,675 (GRCm39) E398K probably damaging Het
Prep T C 10: 44,991,174 (GRCm39) V280A probably benign Het
Prkdc T A 16: 15,526,565 (GRCm39) probably benign Het
Proser3 G A 7: 30,239,563 (GRCm39) R514C probably damaging Het
Ptk7 G A 17: 46,883,688 (GRCm39) probably benign Het
Rbm45 T C 2: 76,208,742 (GRCm39) Y293H probably damaging Het
Rnf213 A C 11: 119,355,878 (GRCm39) E4108A possibly damaging Het
Sdk2 A G 11: 113,747,581 (GRCm39) L643P probably damaging Het
Sec24d C A 3: 123,144,525 (GRCm39) probably benign Het
Sh2d3c C G 2: 32,643,033 (GRCm39) H587D probably damaging Het
Slc1a1 G A 19: 28,878,884 (GRCm39) G208S probably benign Het
Slc35b4 A T 6: 34,135,452 (GRCm39) Y287N probably damaging Het
Slc46a2 T A 4: 59,914,544 (GRCm39) L126F probably damaging Het
Slc4a8 T C 15: 100,698,374 (GRCm39) M621T possibly damaging Het
Slc9b2 T A 3: 135,042,269 (GRCm39) V516D possibly damaging Het
Slco1a6 T A 6: 142,102,948 (GRCm39) probably benign Het
Sncg C T 14: 34,096,495 (GRCm39) V15I probably benign Het
Srgap2 T C 1: 131,283,302 (GRCm39) T260A probably damaging Het
Stk10 T A 11: 32,537,305 (GRCm39) probably benign Het
Taf5 A G 19: 47,064,301 (GRCm39) S415G possibly damaging Het
Tdp1 C T 12: 99,921,217 (GRCm39) probably benign Het
Tdp2 T G 13: 25,025,333 (GRCm39) probably null Het
Tgfbi T A 13: 56,777,587 (GRCm39) I357N probably benign Het
Tmem116 A G 5: 121,633,159 (GRCm39) T178A probably damaging Het
Tnrc6a G A 7: 122,769,617 (GRCm39) R469H probably benign Het
Top2a A T 11: 98,893,729 (GRCm39) L1055* probably null Het
Tox T A 4: 6,842,411 (GRCm39) M40L probably benign Het
Trib2 A T 12: 15,859,930 (GRCm39) H110Q probably benign Het
Trpa1 A G 1: 14,973,439 (GRCm39) I293T possibly damaging Het
Trpv2 A G 11: 62,481,086 (GRCm39) Y395C probably damaging Het
Ubn2 T A 6: 38,411,535 (GRCm39) probably null Het
Ubr4 C T 4: 139,157,487 (GRCm39) T2348M probably damaging Het
Ubxn4 G A 1: 128,190,641 (GRCm39) E256K probably benign Het
Vmn1r33 C A 6: 66,589,510 (GRCm39) G15* probably null Het
Vmn1r37 T A 6: 66,708,769 (GRCm39) S95T probably benign Het
Vmn2r57 A G 7: 41,050,076 (GRCm39) C558R probably damaging Het
Vnn1 T C 10: 23,774,500 (GRCm39) probably null Het
Vps13c T C 9: 67,826,544 (GRCm39) V1395A probably benign Het
Vwa7 A G 17: 35,238,781 (GRCm39) I290V probably benign Het
Wdr93 A G 7: 79,408,221 (GRCm39) E234G probably damaging Het
Zfp385b A T 2: 77,246,291 (GRCm39) S245R probably benign Het
Zfp942 A T 17: 22,147,319 (GRCm39) C437S probably damaging Het
Zfyve9 T A 4: 108,575,902 (GRCm39) E393V possibly damaging Het
Other mutations in Pdzph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Pdzph1 APN 17 59,281,791 (GRCm39) missense possibly damaging 0.46
IGL00644:Pdzph1 APN 17 59,195,105 (GRCm39) missense probably benign
IGL01413:Pdzph1 APN 17 59,186,147 (GRCm39) missense possibly damaging 0.82
IGL01530:Pdzph1 APN 17 59,229,710 (GRCm39) missense probably damaging 1.00
IGL02089:Pdzph1 APN 17 59,274,334 (GRCm39) missense possibly damaging 0.92
IGL02201:Pdzph1 APN 17 59,274,506 (GRCm39) splice site probably benign
IGL02548:Pdzph1 APN 17 59,280,386 (GRCm39) missense probably benign 0.10
IGL02618:Pdzph1 APN 17 59,186,068 (GRCm39) utr 3 prime probably benign
IGL02660:Pdzph1 APN 17 59,187,642 (GRCm39) missense probably damaging 0.97
IGL02749:Pdzph1 APN 17 59,239,478 (GRCm39) missense possibly damaging 0.95
IGL02876:Pdzph1 APN 17 59,281,064 (GRCm39) missense probably benign
IGL03304:Pdzph1 APN 17 59,187,641 (GRCm39) missense probably damaging 1.00
IGL03336:Pdzph1 APN 17 59,281,229 (GRCm39) missense probably benign 0.00
R0008:Pdzph1 UTSW 17 59,229,756 (GRCm39) splice site probably benign
R0498:Pdzph1 UTSW 17 59,280,825 (GRCm39) missense probably benign 0.00
R0553:Pdzph1 UTSW 17 59,229,722 (GRCm39) missense probably damaging 1.00
R0594:Pdzph1 UTSW 17 59,261,474 (GRCm39) missense possibly damaging 0.76
R1306:Pdzph1 UTSW 17 59,239,427 (GRCm39) missense possibly damaging 0.90
R1370:Pdzph1 UTSW 17 59,281,082 (GRCm39) missense possibly damaging 0.73
R1382:Pdzph1 UTSW 17 59,281,742 (GRCm39) missense probably benign 0.10
R1463:Pdzph1 UTSW 17 59,239,440 (GRCm39) missense probably damaging 1.00
R1766:Pdzph1 UTSW 17 59,280,747 (GRCm39) missense probably benign 0.16
R1773:Pdzph1 UTSW 17 59,281,808 (GRCm39) missense probably damaging 0.98
R1862:Pdzph1 UTSW 17 59,229,578 (GRCm39) missense probably damaging 1.00
R2070:Pdzph1 UTSW 17 59,281,092 (GRCm39) missense probably benign 0.04
R2071:Pdzph1 UTSW 17 59,281,092 (GRCm39) missense probably benign 0.04
R2229:Pdzph1 UTSW 17 59,239,407 (GRCm39) splice site probably benign
R2264:Pdzph1 UTSW 17 59,195,162 (GRCm39) critical splice acceptor site probably null
R2334:Pdzph1 UTSW 17 59,229,644 (GRCm39) missense probably damaging 1.00
R3750:Pdzph1 UTSW 17 59,280,331 (GRCm39) nonsense probably null
R4700:Pdzph1 UTSW 17 59,281,541 (GRCm39) missense probably damaging 0.98
R4847:Pdzph1 UTSW 17 59,280,525 (GRCm39) missense possibly damaging 0.95
R4868:Pdzph1 UTSW 17 59,281,751 (GRCm39) missense probably benign 0.00
R5130:Pdzph1 UTSW 17 59,229,604 (GRCm39) missense probably damaging 1.00
R5329:Pdzph1 UTSW 17 59,281,875 (GRCm39) missense probably damaging 1.00
R5574:Pdzph1 UTSW 17 59,280,942 (GRCm39) missense probably benign 0.00
R5770:Pdzph1 UTSW 17 59,186,146 (GRCm39) missense probably damaging 1.00
R5795:Pdzph1 UTSW 17 59,192,862 (GRCm39) missense possibly damaging 0.47
R5842:Pdzph1 UTSW 17 59,281,407 (GRCm39) missense possibly damaging 0.64
R5851:Pdzph1 UTSW 17 59,280,741 (GRCm39) missense probably benign 0.02
R6158:Pdzph1 UTSW 17 59,280,622 (GRCm39) missense probably damaging 0.96
R6813:Pdzph1 UTSW 17 59,281,431 (GRCm39) missense probably benign 0.08
R7022:Pdzph1 UTSW 17 59,281,121 (GRCm39) missense probably benign 0.02
R7395:Pdzph1 UTSW 17 59,186,154 (GRCm39) missense possibly damaging 0.85
R7525:Pdzph1 UTSW 17 59,274,336 (GRCm39) missense possibly damaging 0.73
R7944:Pdzph1 UTSW 17 59,239,455 (GRCm39) missense probably damaging 1.00
R7945:Pdzph1 UTSW 17 59,239,455 (GRCm39) missense probably damaging 1.00
R7992:Pdzph1 UTSW 17 59,186,105 (GRCm39) missense possibly damaging 0.71
R8016:Pdzph1 UTSW 17 59,239,476 (GRCm39) missense probably damaging 0.98
R8116:Pdzph1 UTSW 17 59,282,138 (GRCm39) missense probably benign 0.01
R8273:Pdzph1 UTSW 17 59,280,009 (GRCm39) missense probably benign 0.00
R8523:Pdzph1 UTSW 17 59,191,008 (GRCm39) missense probably damaging 1.00
R8819:Pdzph1 UTSW 17 59,187,715 (GRCm39) nonsense probably null
R8820:Pdzph1 UTSW 17 59,187,715 (GRCm39) nonsense probably null
R8839:Pdzph1 UTSW 17 59,257,237 (GRCm39) missense probably benign 0.02
R8871:Pdzph1 UTSW 17 59,195,033 (GRCm39) missense probably damaging 1.00
R8898:Pdzph1 UTSW 17 59,281,334 (GRCm39) missense probably benign 0.00
R8959:Pdzph1 UTSW 17 59,281,599 (GRCm39) missense probably damaging 0.97
R9043:Pdzph1 UTSW 17 59,280,535 (GRCm39) missense probably benign 0.05
R9083:Pdzph1 UTSW 17 59,261,395 (GRCm39) missense possibly damaging 0.94
R9092:Pdzph1 UTSW 17 59,280,125 (GRCm39) missense probably damaging 1.00
R9682:Pdzph1 UTSW 17 59,257,262 (GRCm39) missense probably damaging 1.00
R9757:Pdzph1 UTSW 17 59,281,898 (GRCm39) nonsense probably null
R9774:Pdzph1 UTSW 17 59,281,751 (GRCm39) missense probably benign 0.00
X0028:Pdzph1 UTSW 17 59,186,116 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGGAGAAAGCCATCATGCTTCAAC -3'
(R):5'- ACATTGCACAGACTTGACTCTGTCATC -3'

Sequencing Primer
(F):5'- GCCATCATGCTTCAACACAAAC -3'
(R):5'- CTGGGTCACAGATAAGTCCTAC -3'
Posted On 2014-04-30