Incidental Mutation 'R0277:Hipk3'
ID 177928
Institutional Source Beutler Lab
Gene Symbol Hipk3
Ensembl Gene ENSMUSG00000027177
Gene Name homeodomain interacting protein kinase 3
Synonyms DYRK6, FIST3
MMRRC Submission 038499-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0277 (G1)
Quality Score 51
Status Validated
Chromosome 2
Chromosomal Location 104256826-104324791 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 104271593 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 446 (L446F)
Ref Sequence ENSEMBL: ENSMUSP00000106754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028600] [ENSMUST00000111124] [ENSMUST00000111125]
AlphaFold Q9ERH7
Predicted Effect probably damaging
Transcript: ENSMUST00000028600
AA Change: L446F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028600
Gene: ENSMUSG00000027177
AA Change: L446F

DomainStartEndE-ValueType
S_TKc 197 525 1.58e-76 SMART
low complexity region 844 859 N/A INTRINSIC
low complexity region 887 906 N/A INTRINSIC
low complexity region 1093 1117 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111124
AA Change: L446F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106753
Gene: ENSMUSG00000027177
AA Change: L446F

DomainStartEndE-ValueType
S_TKc 197 525 1.58e-76 SMART
low complexity region 844 859 N/A INTRINSIC
low complexity region 887 906 N/A INTRINSIC
low complexity region 1093 1117 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111125
AA Change: L446F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106754
Gene: ENSMUSG00000027177
AA Change: L446F

DomainStartEndE-ValueType
S_TKc 197 525 1.58e-76 SMART
low complexity region 865 880 N/A INTRINSIC
low complexity region 908 927 N/A INTRINSIC
low complexity region 1114 1138 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132622
Meta Mutation Damage Score 0.2745 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 95.0%
  • 20x: 89.3%
Validation Efficiency 99% (111/112)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit impaired insulin secretion and glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533L02Rik A G 7: 124,917,815 (GRCm39) K69R unknown Het
Abca13 A C 11: 9,244,701 (GRCm39) D2188A probably benign Het
Acad11 T C 9: 104,001,224 (GRCm39) M708T probably damaging Het
Adam7 T C 14: 68,748,306 (GRCm39) probably null Het
Adgre1 T A 17: 57,751,060 (GRCm39) I578N probably benign Het
Agbl4 T C 4: 111,474,419 (GRCm39) S403P probably damaging Het
Ak3 A G 19: 29,025,192 (GRCm39) M13T possibly damaging Het
Ap2s1 T C 7: 16,481,305 (GRCm39) probably benign Het
Arhgef1 A T 7: 24,623,224 (GRCm39) probably benign Het
Arsk T C 13: 76,223,051 (GRCm39) N182S probably benign Het
Aspscr1 G A 11: 120,569,246 (GRCm39) V15I probably damaging Het
Asxl2 A G 12: 3,492,487 (GRCm39) Y24C probably damaging Het
Atp8b1 A G 18: 64,701,323 (GRCm39) F345S possibly damaging Het
Atp8b3 T C 10: 80,362,743 (GRCm39) K672E probably benign Het
Bltp1 T A 3: 36,997,331 (GRCm39) C1129* probably null Het
Bmp2k A G 5: 97,235,682 (GRCm39) probably benign Het
Casp6 T A 3: 129,704,172 (GRCm39) V86E probably benign Het
Cdca5 A G 19: 6,140,742 (GRCm39) E260G unknown Het
Cpb2 T A 14: 75,502,898 (GRCm39) V159D probably damaging Het
Cylc2 T A 4: 51,228,477 (GRCm39) S183T unknown Het
Dhtkd1 T A 2: 5,919,699 (GRCm39) M561L probably benign Het
Dync2h1 T C 9: 7,129,046 (GRCm39) D1823G probably benign Het
Efcab5 G A 11: 77,031,749 (GRCm39) R42W probably damaging Het
Erc1 T C 6: 119,597,289 (GRCm39) K1003E probably damaging Het
Ezr G A 17: 7,022,164 (GRCm39) Q105* probably null Het
Fam83d T A 2: 158,627,467 (GRCm39) D385E probably benign Het
Fbn2 A G 18: 58,178,389 (GRCm39) C1950R probably damaging Het
Fbxo32 A T 15: 58,047,605 (GRCm39) I236N probably damaging Het
Fcgbp G T 7: 27,784,918 (GRCm39) probably null Het
Foxe3 T C 4: 114,782,805 (GRCm39) N136D probably damaging Het
Fscn2 A T 11: 120,258,837 (GRCm39) I461F probably damaging Het
Gldc A G 19: 30,093,851 (GRCm39) I722T possibly damaging Het
Gm10717 T G 9: 3,025,619 (GRCm39) V68G possibly damaging Het
Gm4841 A G 18: 60,403,718 (GRCm39) L125S possibly damaging Het
Gnl3 A C 14: 30,735,384 (GRCm39) probably null Het
Gsto1 A T 19: 47,846,416 (GRCm39) I88F probably damaging Het
Gucy1b1 T A 3: 81,945,463 (GRCm39) probably null Het
Hhla1 C A 15: 65,820,352 (GRCm39) V133F probably benign Het
Hscb T C 5: 110,982,556 (GRCm39) E177G possibly damaging Het
Hsd17b6 T C 10: 127,827,274 (GRCm39) D266G probably benign Het
Ipo4 T C 14: 55,869,572 (GRCm39) S363G probably benign Het
Kcnip3 A G 2: 127,301,899 (GRCm39) probably benign Het
Klhl41 A G 2: 69,501,640 (GRCm39) Y367C probably damaging Het
Klk1b4 C G 7: 43,861,053 (GRCm39) P232R possibly damaging Het
Lcp2 A G 11: 34,004,322 (GRCm39) D53G probably damaging Het
Llgl2 A G 11: 115,741,546 (GRCm39) K559E probably damaging Het
Lrrc59 A C 11: 94,534,248 (GRCm39) T269P probably damaging Het
Mark1 A G 1: 184,677,149 (GRCm39) S34P possibly damaging Het
Megf11 G A 9: 64,598,632 (GRCm39) probably null Het
Mplkip A G 13: 17,871,565 (GRCm39) I159V possibly damaging Het
Muc4 C A 16: 32,755,690 (GRCm38) probably benign Het
Myo18b A G 5: 112,841,213 (GRCm39) probably benign Het
Myo9b T C 8: 71,808,596 (GRCm39) probably benign Het
Napg C T 18: 63,120,034 (GRCm39) R149C probably damaging Het
Ndrg3 A G 2: 156,776,855 (GRCm39) probably benign Het
Nfe2l3 T A 6: 51,434,448 (GRCm39) M336K probably benign Het
Nrxn1 A C 17: 91,008,170 (GRCm39) probably null Het
Nsun3 A T 16: 62,597,007 (GRCm39) probably benign Het
Nuak1 T C 10: 84,210,315 (GRCm39) E591G probably benign Het
Or10g1b T C 14: 52,627,846 (GRCm39) Y128C probably damaging Het
Or10s1 G A 9: 39,986,010 (GRCm39) V140I probably benign Het
Or1e17 A T 11: 73,831,773 (GRCm39) I234F probably benign Het
Or4k2 T C 14: 50,423,789 (GRCm39) N296S probably null Het
Or6c70 T A 10: 129,709,936 (GRCm39) Q230L probably damaging Het
Or6d15 A T 6: 116,559,562 (GRCm39) V115E probably damaging Het
Or6z6 T A 7: 6,491,433 (GRCm39) M147L probably benign Het
Orc4 A T 2: 48,827,479 (GRCm39) V38E possibly damaging Het
Ovgp1 T C 3: 105,887,208 (GRCm39) probably benign Het
Palm3 T A 8: 84,755,349 (GRCm39) V287D probably damaging Het
Pde4dip T A 3: 97,751,028 (GRCm39) H62L probably benign Het
Pdk4 G T 6: 5,491,620 (GRCm39) P100Q probably damaging Het
Pdss2 T A 10: 43,248,172 (GRCm39) H225Q probably benign Het
Pkhd1 A T 1: 20,345,762 (GRCm39) D2755E probably benign Het
Prune2 A T 19: 17,098,753 (GRCm39) D1419V probably damaging Het
Pth2r A C 1: 65,427,775 (GRCm39) I483L probably benign Het
Qrsl1 A G 10: 43,772,003 (GRCm39) probably null Het
Rab11fip4 A G 11: 79,577,455 (GRCm39) H403R possibly damaging Het
Ralgapa1 A T 12: 55,724,023 (GRCm39) I1548N probably damaging Het
Ric8a T G 7: 140,437,813 (GRCm39) probably benign Het
Rsbn1 T C 3: 103,821,897 (GRCm39) F44S possibly damaging Het
Serpinc1 T A 1: 160,817,272 (GRCm39) M1K probably null Het
Sf3b1 T C 1: 55,058,416 (GRCm39) I58V probably damaging Het
Sh3d19 T A 3: 86,033,978 (GRCm39) M777K probably benign Het
Sipa1 A T 19: 5,704,093 (GRCm39) M743K probably benign Het
Skint5 T C 4: 113,794,818 (GRCm39) H255R probably benign Het
Slco6b1 A T 1: 96,916,398 (GRCm39) noncoding transcript Het
Slfn4 A T 11: 83,077,777 (GRCm39) R188S probably damaging Het
Sort1 T C 3: 108,231,908 (GRCm39) probably benign Het
Spg21 A T 9: 65,372,629 (GRCm39) K20N possibly damaging Het
Sptbn2 A T 19: 4,795,173 (GRCm39) I1544F probably benign Het
Srf T C 17: 46,860,415 (GRCm39) T456A possibly damaging Het
Ssbp2 T A 13: 91,712,715 (GRCm39) probably benign Het
Stx2 C T 5: 129,065,967 (GRCm39) V230I probably benign Het
Sv2b A T 7: 74,856,187 (GRCm39) D34E possibly damaging Het
Synpo2l A G 14: 20,711,856 (GRCm39) S255P probably damaging Het
Tbx15 C T 3: 99,259,707 (GRCm39) P526L probably damaging Het
Tenm4 C A 7: 96,344,157 (GRCm39) P250Q possibly damaging Het
Tgm1 C A 14: 55,948,384 (GRCm39) probably benign Het
Tgm1 T C 14: 55,950,109 (GRCm39) probably benign Het
Thsd7b A G 1: 130,123,000 (GRCm39) I1540V probably benign Het
Tnrc6c A G 11: 117,630,707 (GRCm39) K1023E probably damaging Het
Ube2l6 A T 2: 84,636,771 (GRCm39) probably null Het
Uty T A Y: 1,169,979 (GRCm39) I326F probably damaging Het
Wdfy4 T C 14: 32,805,742 (GRCm39) D1735G possibly damaging Het
Wnt11 A G 7: 98,496,590 (GRCm39) K177E probably damaging Het
Wnt5a A T 14: 28,235,225 (GRCm39) M70L possibly damaging Het
Wwc1 T A 11: 35,743,175 (GRCm39) E882V probably damaging Het
Zfp455 G T 13: 67,346,728 (GRCm39) probably null Het
Zmpste24 A G 4: 120,940,050 (GRCm39) Y199H probably damaging Het
Other mutations in Hipk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Hipk3 APN 2 104,260,576 (GRCm39) missense possibly damaging 0.52
IGL00937:Hipk3 APN 2 104,263,517 (GRCm39) missense possibly damaging 0.82
IGL01719:Hipk3 APN 2 104,267,434 (GRCm39) missense possibly damaging 0.78
IGL01802:Hipk3 APN 2 104,302,198 (GRCm39) splice site probably benign
IGL01932:Hipk3 APN 2 104,301,326 (GRCm39) missense probably damaging 1.00
IGL02089:Hipk3 APN 2 104,261,724 (GRCm39) missense probably damaging 1.00
IGL02522:Hipk3 APN 2 104,301,676 (GRCm39) missense probably damaging 1.00
IGL02525:Hipk3 APN 2 104,301,757 (GRCm39) missense probably damaging 1.00
IGL02959:Hipk3 APN 2 104,301,604 (GRCm39) missense probably damaging 1.00
IGL02986:Hipk3 APN 2 104,264,086 (GRCm39) missense probably damaging 1.00
R0136:Hipk3 UTSW 2 104,269,638 (GRCm39) missense probably benign 0.02
R0308:Hipk3 UTSW 2 104,263,552 (GRCm39) missense probably damaging 0.99
R0367:Hipk3 UTSW 2 104,261,594 (GRCm39) nonsense probably null
R0597:Hipk3 UTSW 2 104,263,982 (GRCm39) missense possibly damaging 0.94
R1079:Hipk3 UTSW 2 104,302,043 (GRCm39) missense probably benign 0.00
R1171:Hipk3 UTSW 2 104,302,021 (GRCm39) missense probably benign 0.02
R1244:Hipk3 UTSW 2 104,263,601 (GRCm39) missense probably damaging 1.00
R1509:Hipk3 UTSW 2 104,271,607 (GRCm39) missense probably benign 0.01
R1616:Hipk3 UTSW 2 104,264,090 (GRCm39) nonsense probably null
R1893:Hipk3 UTSW 2 104,263,601 (GRCm39) missense probably damaging 1.00
R1938:Hipk3 UTSW 2 104,260,533 (GRCm39) missense possibly damaging 0.89
R1969:Hipk3 UTSW 2 104,264,186 (GRCm39) missense probably damaging 1.00
R1975:Hipk3 UTSW 2 104,301,518 (GRCm39) missense probably benign 0.00
R1985:Hipk3 UTSW 2 104,264,780 (GRCm39) missense probably benign 0.16
R2105:Hipk3 UTSW 2 104,269,737 (GRCm39) missense probably damaging 0.97
R2422:Hipk3 UTSW 2 104,301,830 (GRCm39) missense probably benign 0.01
R3028:Hipk3 UTSW 2 104,264,135 (GRCm39) missense probably benign
R3747:Hipk3 UTSW 2 104,271,628 (GRCm39) nonsense probably null
R3923:Hipk3 UTSW 2 104,301,107 (GRCm39) missense probably damaging 1.00
R4320:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R4321:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R4322:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R4323:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R4324:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R4595:Hipk3 UTSW 2 104,271,622 (GRCm39) missense probably benign 0.01
R4604:Hipk3 UTSW 2 104,269,674 (GRCm39) missense probably damaging 1.00
R4657:Hipk3 UTSW 2 104,264,104 (GRCm39) missense probably benign 0.00
R5193:Hipk3 UTSW 2 104,260,345 (GRCm39) missense possibly damaging 0.94
R5769:Hipk3 UTSW 2 104,265,298 (GRCm39) missense possibly damaging 0.69
R5843:Hipk3 UTSW 2 104,270,569 (GRCm39) missense possibly damaging 0.65
R5906:Hipk3 UTSW 2 104,302,153 (GRCm39) missense probably damaging 1.00
R5976:Hipk3 UTSW 2 104,301,529 (GRCm39) missense probably damaging 1.00
R5991:Hipk3 UTSW 2 104,268,328 (GRCm39) missense probably damaging 1.00
R6214:Hipk3 UTSW 2 104,264,086 (GRCm39) missense probably damaging 1.00
R6215:Hipk3 UTSW 2 104,264,086 (GRCm39) missense probably damaging 1.00
R6285:Hipk3 UTSW 2 104,301,770 (GRCm39) missense probably damaging 1.00
R6523:Hipk3 UTSW 2 104,269,753 (GRCm39) missense possibly damaging 0.50
R6713:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R7381:Hipk3 UTSW 2 104,269,696 (GRCm39) missense probably damaging 0.99
R7517:Hipk3 UTSW 2 104,265,059 (GRCm39) missense probably benign 0.00
R8780:Hipk3 UTSW 2 104,264,179 (GRCm39) missense probably damaging 0.99
R8843:Hipk3 UTSW 2 104,268,242 (GRCm39) missense probably benign 0.21
R9186:Hipk3 UTSW 2 104,301,439 (GRCm39) missense probably damaging 1.00
R9187:Hipk3 UTSW 2 104,276,936 (GRCm39) missense probably damaging 1.00
R9374:Hipk3 UTSW 2 104,301,850 (GRCm39) missense probably benign
R9398:Hipk3 UTSW 2 104,263,562 (GRCm39) missense probably benign 0.01
R9552:Hipk3 UTSW 2 104,301,850 (GRCm39) missense probably benign
R9584:Hipk3 UTSW 2 104,301,910 (GRCm39) missense probably benign 0.01
R9641:Hipk3 UTSW 2 104,267,376 (GRCm39) missense probably benign
X0021:Hipk3 UTSW 2 104,271,711 (GRCm39) critical splice acceptor site probably null
Z1088:Hipk3 UTSW 2 104,264,974 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTCATGCCTGACACATTTAGCCTAATAC -3'
(R):5'- AGGCAACGCTGACTACATTTATTTTAGACTT -3'

Sequencing Primer
(F):5'- aggagagggcatcggac -3'
(R):5'- GACTTAAAACACTGCATATTCCTTCC -3'
Posted On 2014-04-30