Incidental Mutation 'F5770:Olfr1406'
ID177956
Institutional Source Beutler Lab
Gene Symbol Olfr1406
Ensembl Gene ENSMUSG00000058981
Gene Nameolfactory receptor 1406
SynonymsMOR267-5, GA_x6K02T2R7CC-664297-665229
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #F5770 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location173181853-173190640 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 173183964 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 157 (L157I)
Ref Sequence ENSEMBL: ENSMUSP00000151023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072395] [ENSMUST00000201132] [ENSMUST00000215878]
Predicted Effect probably benign
Transcript: ENSMUST00000072395
AA Change: L157I

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000072231
Gene: ENSMUSG00000058981
AA Change: L157I

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.9e-55 PFAM
Pfam:7tm_1 41 289 2.7e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201132
AA Change: L157I

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000144530
Gene: ENSMUSG00000058981
AA Change: L157I

DomainStartEndE-ValueType
Pfam:7tm_4 31 88 5.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215878
AA Change: L157I

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 99% (96/97)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,701,257 H102L possibly damaging Het
Abcb5 T A 12: 118,886,179 M950L probably benign Het
AC139131.1 T G 7: 12,481,196 probably benign Het
Ahcy G A 2: 155,064,921 R151* probably null Het
Arhgef38 T G 3: 133,149,540 H262P probably damaging Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Camk2g T C 14: 20,739,312 probably benign Het
Casp8ap2 C T 4: 32,639,944 H333Y probably benign Het
Cd36 ACTGTCTGT ACTGT 5: 17,820,528 probably null Het
Cdc42bpb C T 12: 111,296,391 G1501S probably benign Het
Cfi T A 3: 129,854,992 I175K possibly damaging Het
Clasp1 G A 1: 118,581,348 R1027Q probably damaging Het
D630003M21Rik T C 2: 158,201,011 T870A probably benign Het
Dcaf4 C A 12: 83,537,701 probably null Het
Dnah12 T A 14: 26,773,093 N1369K possibly damaging Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Dpyd C T 3: 118,897,126 Q295* probably null Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Fbrsl1 C T 5: 110,379,426 A129T possibly damaging Het
Fcgr1 T C 3: 96,284,276 *405W probably null Het
Gdap1l1 C T 2: 163,447,486 probably benign Het
Glrx3 A G 7: 137,459,153 H172R probably benign Het
Gm10770 T A 2: 150,179,484 K38* probably null Het
Gm20517 G A 17: 47,618,832 V65M probably damaging Het
Gm4787 G A 12: 81,377,567 Q606* probably null Het
Golga4 A G 9: 118,556,075 E727G possibly damaging Het
Got1 T A 19: 43,500,561 probably benign Het
Heatr5a A G 12: 51,881,278 probably benign Het
Hira G A 16: 18,894,821 A29T probably damaging Het
Hnrnpab A T 11: 51,602,624 N252K probably benign Het
Ing1 T C 8: 11,561,934 V124A probably damaging Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Klc1 A T 12: 111,774,572 I161F probably benign Het
Lpar5 C A 6: 125,081,727 A137E possibly damaging Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Lrrc37a T G 11: 103,455,512 N3176T possibly damaging Het
Mbd5 A G 2: 49,316,410 D1713G probably damaging Het
Mctp2 T A 7: 72,121,751 probably benign Het
Muc6 T G 7: 141,647,613 E808A probably benign Het
Mylk G T 16: 34,995,204 probably null Het
Myrfl T C 10: 116,861,530 T30A probably damaging Het
Nbeal2 A G 9: 110,637,937 V670A possibly damaging Het
Nphp3 T C 9: 104,035,894 probably null Het
Numbl T C 7: 27,279,602 S379P probably benign Het
Olfr1440 G A 19: 12,394,550 V96I probably benign Het
Olfr480 G T 7: 108,066,678 T40K probably benign Het
Otop3 T A 11: 115,344,838 L432Q probably damaging Het
Papln C T 12: 83,778,834 R608C possibly damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pigx T C 16: 32,087,422 D129G probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T C 7: 100,654,618 T112A probably benign Het
Ppwd1 A G 13: 104,220,237 Y257H probably damaging Het
Prkcb G T 7: 122,528,476 W274C probably damaging Het
Rabep1 T C 11: 70,937,516 probably benign Het
Ralgapa1 G A 12: 55,795,653 probably benign Het
Rasa1 A G 13: 85,226,945 probably null Het
Rbbp8nl T A 2: 180,278,208 T558S probably benign Het
Recql4 T C 15: 76,706,169 D705G possibly damaging Het
Ror1 A G 4: 100,440,933 Q501R probably damaging Het
Rundc3b TGCCGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGCCGC 5: 8,622,549 probably benign Het
Sirpb1b A G 3: 15,503,183 V366A probably benign Het
Slc30a4 T A 2: 122,689,538 M136L probably benign Het
Slc5a6 C T 5: 31,042,613 probably null Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Spata31 C A 13: 64,921,648 P537T probably benign Het
Sptbn2 C T 19: 4,750,632 R2292C probably damaging Het
Thbd A T 2: 148,407,190 Y253N probably benign Het
Tiam1 C T 16: 89,865,271 R653H probably damaging Het
Tmc3 T C 7: 83,622,505 V955A probably benign Het
Tnrc6c G A 11: 117,723,326 R770H probably damaging Het
Toe1 A T 4: 116,806,111 N56K probably damaging Het
Tprkb A G 6: 85,928,782 K150E probably damaging Het
Trps1 T C 15: 50,831,577 K150E probably damaging Het
Tspyl3 A G 2: 153,225,060 V86A probably benign Het
Ttc23 T C 7: 67,709,315 probably benign Het
Ttc36 A T 9: 44,801,797 probably benign Het
Tubb3 C T 8: 123,411,675 probably benign Het
Vmn2r68 C T 7: 85,221,880 V732I probably benign Het
Vps18 A G 2: 119,297,228 Y844C probably benign Het
Wdr60 A C 12: 116,211,840 S906A possibly damaging Het
Wdr72 T A 9: 74,157,270 I528N probably damaging Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zfp933 G A 4: 147,826,470 A223V probably damaging Het
Zmynd8 G A 2: 165,812,394 R724* probably null Het
Other mutations in Olfr1406
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Olfr1406 APN 1 173183623 missense probably benign 0.45
IGL01609:Olfr1406 APN 1 173184276 missense probably benign 0.00
IGL01996:Olfr1406 APN 1 173183727 missense probably benign 0.00
PIT4378001:Olfr1406 UTSW 1 173183814 missense probably benign 0.00
R0053:Olfr1406 UTSW 1 173184278 missense probably benign 0.35
R0800:Olfr1406 UTSW 1 173184060 missense probably damaging 1.00
R1793:Olfr1406 UTSW 1 173184409 missense probably benign
R2230:Olfr1406 UTSW 1 173183615 missense probably benign 0.04
R2232:Olfr1406 UTSW 1 173183615 missense probably benign 0.04
R5395:Olfr1406 UTSW 1 173183680 nonsense probably null
R5455:Olfr1406 UTSW 1 173184251 missense probably damaging 1.00
R5457:Olfr1406 UTSW 1 173183613 missense probably damaging 1.00
R5558:Olfr1406 UTSW 1 173184018 missense probably benign 0.01
R5760:Olfr1406 UTSW 1 173183751 missense probably benign 0.05
R6285:Olfr1406 UTSW 1 173183910 missense probably damaging 1.00
R7159:Olfr1406 UTSW 1 173184323 missense possibly damaging 0.95
R7676:Olfr1406 UTSW 1 173183553 nonsense probably null
V7580:Olfr1406 UTSW 1 173183964 missense probably benign 0.05
V7581:Olfr1406 UTSW 1 173183964 missense probably benign 0.05
V7582:Olfr1406 UTSW 1 173183964 missense probably benign 0.05
Predicted Primers
Posted On2014-05-07