Mutagenetix > Incidental Mutations

Incidental Mutation 'F5770:Vps18'

177958

Institutional Source

Beutler Lab

Gene Symbol

Vps18

Ensembl Gene

ENSMUSG00000034216

Gene Name

VPS18 CORVET/HOPS core subunit

Synonyms

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

F5770 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119288740-119298453 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 119297228 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 844 (Y844C)

Ref Sequence

ENSEMBL: ENSMUSP00000036915 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037280]

Predicted Effect

probably benign
Transcript: ENSMUST00000037280
AA Change: Y844C

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000036915
Gene: ENSMUSG00000034216
AA Change: Y844C

Domain	Start	End	E-Value	Type
Pfam:Pep3_Vps18	291	435	2.4e-41	PFAM
low complexity region	486	500	N/A	INTRINSIC
Pfam:Clathrin	619	771	5.9e-11	PFAM
coiled coil region	803	845	N/A	INTRINSIC
Blast:RING	853	947	3e-47	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139367

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151500

Meta Mutation Damage Score

0.1253

Coding Region Coverage

1x: 0.0%
3x: 0.0%
10x: 0.0%
20x: 0.0%

Validation Efficiency

99% (96/97)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps18 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele exhibit preweaning lethality. Mice homozygous for a conditional allele activated in the nervous system exhibit impaired neuron migration and neurodegeneration associated with increased apoptosis and impaired autophagy and endocytosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530002B09Rik	A	T	4: 122,701,257	H102L	possibly damaging	Het
Abcb5	T	A	12: 118,886,179	M950L	probably benign	Het
AC139131.1	T	G	7: 12,481,196		probably benign	Het
Ahcy	G	A	2: 155,064,921	R151*	probably null	Het
Arhgef38	T	G	3: 133,149,540	H262P	probably damaging	Het
Atp6v1h	A	G	1: 5,124,443	T282A	possibly damaging	Het
Camk2g	T	C	14: 20,739,312		probably benign	Het
Casp8ap2	C	T	4: 32,639,944	H333Y	probably benign	Het
Cd36	ACTGTCTGT	ACTGT	5: 17,820,528		probably null	Het
Cdc42bpb	C	T	12: 111,296,391	G1501S	probably benign	Het
Cfi	T	A	3: 129,854,992	I175K	possibly damaging	Het
Clasp1	G	A	1: 118,581,348	R1027Q	probably damaging	Het
D630003M21Rik	T	C	2: 158,201,011	T870A	probably benign	Het
Dcaf4	C	A	12: 83,537,701		probably null	Het
Dnah12	T	A	14: 26,773,093	N1369K	possibly damaging	Het
Dnajc22	T	A	15: 99,101,482	Y183N	probably damaging	Het
Dpyd	C	T	3: 118,897,126	Q295*	probably null	Het
Erv3	T	C	2: 131,855,926	H171R	possibly damaging	Het
Fam221b	T	C	4: 43,665,865	T249A	probably benign	Het
Fbrsl1	C	T	5: 110,379,426	A129T	possibly damaging	Het
Fcgr1	T	C	3: 96,284,276	*405W	probably null	Het
Gdap1l1	C	T	2: 163,447,486		probably benign	Het
Glrx3	A	G	7: 137,459,153	H172R	probably benign	Het
Gm10770	T	A	2: 150,179,484	K38*	probably null	Het
Gm20517	G	A	17: 47,618,832	V65M	probably damaging	Het
Gm4787	G	A	12: 81,377,567	Q606*	probably null	Het
Golga4	A	G	9: 118,556,075	E727G	possibly damaging	Het
Got1	T	A	19: 43,500,561		probably benign	Het
Heatr5a	A	G	12: 51,881,278		probably benign	Het
Hira	G	A	16: 18,894,821	A29T	probably damaging	Het
Hnrnpab	A	T	11: 51,602,624	N252K	probably benign	Het
Ing1	T	C	8: 11,561,934	V124A	probably damaging	Het
Izumo4	A	T	10: 80,703,891	T155S	probably benign	Het
Kcnb2	A	G	1: 15,710,091	I396V	probably benign	Het
Klc1	A	T	12: 111,774,572	I161F	probably benign	Het
Lpar5	C	A	6: 125,081,727	A137E	possibly damaging	Het
Lrp4	C	T	2: 91,488,518	S900L	possibly damaging	Het
Lrrc37a	T	G	11: 103,455,512	N3176T	possibly damaging	Het
Mbd5	A	G	2: 49,316,410	D1713G	probably damaging	Het
Mctp2	T	A	7: 72,121,751		probably benign	Het
Muc6	T	G	7: 141,647,613	E808A	probably benign	Het
Mylk	G	T	16: 34,995,204		probably null	Het
Myrfl	T	C	10: 116,861,530	T30A	probably damaging	Het
Nbeal2	A	G	9: 110,637,937	V670A	possibly damaging	Het
Nphp3	T	C	9: 104,035,894		probably null	Het
Numbl	T	C	7: 27,279,602	S379P	probably benign	Het
Olfr1406	G	T	1: 173,183,964	L157I	probably benign	Het
Olfr1440	G	A	19: 12,394,550	V96I	probably benign	Het
Olfr480	G	T	7: 108,066,678	T40K	probably benign	Het
Otop3	T	A	11: 115,344,838	L432Q	probably damaging	Het
Papln	C	T	12: 83,778,834	R608C	possibly damaging	Het
Pelp1	T	A	11: 70,398,150	T257S	probably damaging	Het
Pigx	T	C	16: 32,087,422	D129G	probably damaging	Het
Pik3cd	A	C	4: 149,657,319	L390R	probably damaging	Het
Plekhb1	T	C	7: 100,654,618	T112A	probably benign	Het
Ppwd1	A	G	13: 104,220,237	Y257H	probably damaging	Het
Prkcb	G	T	7: 122,528,476	W274C	probably damaging	Het
Rabep1	T	C	11: 70,937,516		probably benign	Het
Ralgapa1	G	A	12: 55,795,653		probably benign	Het
Rasa1	A	G	13: 85,226,945		probably null	Het
Rbbp8nl	T	A	2: 180,278,208	T558S	probably benign	Het
Recql4	T	C	15: 76,706,169	D705G	possibly damaging	Het
Ror1	A	G	4: 100,440,933	Q501R	probably damaging	Het
Rundc3b	TGCCGCCGCCGCCGCCGCCGCCGCCGC	TGCCGCCGCCGCCGCCGCCGCCGC	5: 8,622,549		probably benign	Het
Sirpb1b	A	G	3: 15,503,183	V366A	probably benign	Het
Slc30a4	T	A	2: 122,689,538	M136L	probably benign	Het
Slc5a6	C	T	5: 31,042,613		probably null	Het
Spaca1	T	C	4: 34,039,311	E192G	probably damaging	Het
Spata31	C	A	13: 64,921,648	P537T	probably benign	Het
Sptbn2	C	T	19: 4,750,632	R2292C	probably damaging	Het
Thbd	A	T	2: 148,407,190	Y253N	probably benign	Het
Tiam1	C	T	16: 89,865,271	R653H	probably damaging	Het
Tmc3	T	C	7: 83,622,505	V955A	probably benign	Het
Tnrc6c	G	A	11: 117,723,326	R770H	probably damaging	Het
Toe1	A	T	4: 116,806,111	N56K	probably damaging	Het
Tprkb	A	G	6: 85,928,782	K150E	probably damaging	Het
Trps1	T	C	15: 50,831,577	K150E	probably damaging	Het
Tspyl3	A	G	2: 153,225,060	V86A	probably benign	Het
Ttc23	T	C	7: 67,709,315		probably benign	Het
Ttc36	A	T	9: 44,801,797		probably benign	Het
Tubb3	C	T	8: 123,411,675		probably benign	Het
Vmn2r68	C	T	7: 85,221,880	V732I	probably benign	Het
Wdr60	A	C	12: 116,211,840	S906A	possibly damaging	Het
Wdr72	T	A	9: 74,157,270	I528N	probably damaging	Het
Zfp292	C	T	4: 34,806,783	C2087Y	possibly damaging	Het
Zfp933	G	A	4: 147,826,470	A223V	probably damaging	Het
Zmynd8	G	A	2: 165,812,394	R724*	probably null	Het

Other mutations in Vps18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01627:Vps18	APN	2	119297191	missense	probably benign	0.03
IGL02311:Vps18	APN	2	119290251	missense	probably benign	0.05
IGL02332:Vps18	APN	2	119293810	missense	probably benign	0.04
IGL03089:Vps18	APN	2	119293177	missense	probably benign	0.01
IGL03114:Vps18	APN	2	119293651	missense	possibly damaging	0.55
IGL03334:Vps18	APN	2	119297482	missense	probably damaging	1.00
R0311:Vps18	UTSW	2	119297365	missense	probably benign	0.05
R0346:Vps18	UTSW	2	119297164	missense	probably damaging	1.00
R0373:Vps18	UTSW	2	119293905	missense	probably damaging	0.99
R0637:Vps18	UTSW	2	119293905	missense	probably damaging	0.99
R1493:Vps18	UTSW	2	119297132	missense	probably damaging	1.00
R1703:Vps18	UTSW	2	119289057	missense	probably benign	0.03
R1734:Vps18	UTSW	2	119293942	missense	probably benign	0.01
R4297:Vps18	UTSW	2	119297331	nonsense	probably null
R4633:Vps18	UTSW	2	119293276	missense	probably damaging	1.00
R4729:Vps18	UTSW	2	119293791	missense	probably damaging	1.00
R5034:Vps18	UTSW	2	119293306	missense	probably benign	0.00
R5162:Vps18	UTSW	2	119292942	missense	probably benign	0.19
R5320:Vps18	UTSW	2	119297377	nonsense	probably null
R5857:Vps18	UTSW	2	119297533	missense	probably damaging	1.00
R6105:Vps18	UTSW	2	119289062	missense	probably damaging	1.00
R6150:Vps18	UTSW	2	119297592	nonsense	probably null
R8018:Vps18	UTSW	2	119294011	missense	not run
RF002:Vps18	UTSW	2	119297390	missense	probably damaging	1.00
V7583:Vps18	UTSW	2	119297228	missense	probably benign	0.22

Predicted Primers

Posted On

2014-05-07