Incidental Mutation 'F5770:Thbd'
ID 177961
Institutional Source Beutler Lab
Gene Symbol Thbd
Ensembl Gene ENSMUSG00000074743
Gene Name thrombomodulin
Synonyms CD141, TM
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # F5770 (G1)
Quality Score 179
Status Validated
Chromosome 2
Chromosomal Location 148246391-148250108 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 148249110 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 253 (Y253N)
Ref Sequence ENSEMBL: ENSMUSP00000096877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099270]
AlphaFold P15306
Predicted Effect probably benign
Transcript: ENSMUST00000099270
AA Change: Y253N

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000096877
Gene: ENSMUSG00000074743
AA Change: Y253N

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
CLECT 24 166 2.78e-18 SMART
EGF 243 280 2.2e1 SMART
EGF 286 323 1.47e-3 SMART
EGF_CA 324 362 7.81e-8 SMART
EGF 367 404 3.57e-2 SMART
EGF 406 439 2.53e1 SMART
EGF 443 480 2.39e1 SMART
low complexity region 490 511 N/A INTRINSIC
transmembrane domain 519 541 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 99% (96/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this intronless gene is an endothelial-specific type I membrane receptor that binds thrombin. This binding results in the activation of protein C, which degrades clotting factors Va and VIIIa and reduces the amount of thrombin generated. Mutations in this gene are a cause of thromboembolic disease, also known as inherited thrombophilia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted null mutants are growth retarded and die by embryonic day 9.5. Embryos develop further in vitro than in vivo suggesting maternal-fetal incompatibility. Endothelial cell-specific, conditional knockouts suffer fatal juvenile thromboses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,595,050 (GRCm39) H102L possibly damaging Het
Abcb5 T A 12: 118,849,914 (GRCm39) M950L probably benign Het
Ahcy G A 2: 154,906,841 (GRCm39) R151* probably null Het
Arhgef38 T G 3: 132,855,301 (GRCm39) H262P probably damaging Het
Atp6v1h A G 1: 5,194,666 (GRCm39) T282A possibly damaging Het
Camk2g T C 14: 20,789,380 (GRCm39) probably benign Het
Casp8ap2 C T 4: 32,639,944 (GRCm39) H333Y probably benign Het
Cd36 ACTGTCTGT ACTGT 5: 18,025,526 (GRCm39) probably null Het
Cdc42bpb C T 12: 111,262,825 (GRCm39) G1501S probably benign Het
Cfi T A 3: 129,648,641 (GRCm39) I175K possibly damaging Het
Clasp1 G A 1: 118,509,078 (GRCm39) R1027Q probably damaging Het
D630003M21Rik T C 2: 158,042,931 (GRCm39) T870A probably benign Het
Dcaf4 C A 12: 83,584,475 (GRCm39) probably null Het
Dnah12 T A 14: 26,495,050 (GRCm39) N1369K possibly damaging Het
Dnajc22 T A 15: 98,999,363 (GRCm39) Y183N probably damaging Het
Dpyd C T 3: 118,690,775 (GRCm39) Q295* probably null Het
Dync2i1 A C 12: 116,175,460 (GRCm39) S906A possibly damaging Het
Erv3 T C 2: 131,697,846 (GRCm39) H171R possibly damaging Het
Fam221b T C 4: 43,665,865 (GRCm39) T249A probably benign Het
Fbrsl1 C T 5: 110,527,292 (GRCm39) A129T possibly damaging Het
Fcgr1 T C 3: 96,191,592 (GRCm39) *405W probably null Het
Gdap1l1 C T 2: 163,289,406 (GRCm39) probably benign Het
Glrx3 A G 7: 137,060,882 (GRCm39) H172R probably benign Het
Gm10770 T A 2: 150,021,404 (GRCm39) K38* probably null Het
Gm20517 G A 17: 47,929,757 (GRCm39) V65M probably damaging Het
Gm4787 G A 12: 81,424,341 (GRCm39) Q606* probably null Het
Golga4 A G 9: 118,385,143 (GRCm39) E727G possibly damaging Het
Got1 T A 19: 43,489,000 (GRCm39) probably benign Het
Heatr5a A G 12: 51,928,061 (GRCm39) probably benign Het
Hira G A 16: 18,713,571 (GRCm39) A29T probably damaging Het
Hnrnpab A T 11: 51,493,451 (GRCm39) N252K probably benign Het
Ing1 T C 8: 11,611,934 (GRCm39) V124A probably damaging Het
Izumo4 A T 10: 80,539,725 (GRCm39) T155S probably benign Het
Kcnb2 A G 1: 15,780,315 (GRCm39) I396V probably benign Het
Klc1 A T 12: 111,741,006 (GRCm39) I161F probably benign Het
Lpar5 C A 6: 125,058,690 (GRCm39) A137E possibly damaging Het
Lrp4 C T 2: 91,318,863 (GRCm39) S900L possibly damaging Het
Lrrc37a T G 11: 103,346,338 (GRCm39) N3176T possibly damaging Het
Mbd5 A G 2: 49,206,422 (GRCm39) D1713G probably damaging Het
Mctp2 T A 7: 71,771,499 (GRCm39) probably benign Het
Muc6 T G 7: 141,233,880 (GRCm39) E808A probably benign Het
Mylk G T 16: 34,815,574 (GRCm39) probably null Het
Myrfl T C 10: 116,697,435 (GRCm39) T30A probably damaging Het
Nbeal2 A G 9: 110,467,005 (GRCm39) V670A possibly damaging Het
Nphp3 T C 9: 103,913,093 (GRCm39) probably null Het
Numbl T C 7: 26,979,027 (GRCm39) S379P probably benign Het
Or10j7 G T 1: 173,011,531 (GRCm39) L157I probably benign Het
Or5an6 G A 19: 12,371,914 (GRCm39) V96I probably benign Het
Or5p57 G T 7: 107,665,885 (GRCm39) T40K probably benign Het
Otop3 T A 11: 115,235,664 (GRCm39) L432Q probably damaging Het
Papln C T 12: 83,825,608 (GRCm39) R608C possibly damaging Het
Pelp1 T A 11: 70,288,976 (GRCm39) T257S probably damaging Het
Pigx T C 16: 31,906,240 (GRCm39) D129G probably damaging Het
Pik3cd A C 4: 149,741,776 (GRCm39) L390R probably damaging Het
Plekhb1 T C 7: 100,303,825 (GRCm39) T112A probably benign Het
Ppwd1 A G 13: 104,356,745 (GRCm39) Y257H probably damaging Het
Prkcb G T 7: 122,127,699 (GRCm39) W274C probably damaging Het
Rabep1 T C 11: 70,828,342 (GRCm39) probably benign Het
Ralgapa1 G A 12: 55,842,438 (GRCm39) probably benign Het
Rasa1 A G 13: 85,375,064 (GRCm39) probably null Het
Rbbp8nl T A 2: 179,920,001 (GRCm39) T558S probably benign Het
Recql4 T C 15: 76,590,369 (GRCm39) D705G possibly damaging Het
Ror1 A G 4: 100,298,130 (GRCm39) Q501R probably damaging Het
Rundc3b TGCCGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGCCGC 5: 8,672,549 (GRCm39) probably benign Het
Sirpb1b A G 3: 15,568,243 (GRCm39) V366A probably benign Het
Slc30a4 T A 2: 122,531,458 (GRCm39) M136L probably benign Het
Slc5a6 C T 5: 31,199,957 (GRCm39) probably null Het
Spaca1 T C 4: 34,039,311 (GRCm39) E192G probably damaging Het
Spata31 C A 13: 65,069,462 (GRCm39) P537T probably benign Het
Sptbn2 C T 19: 4,800,660 (GRCm39) R2292C probably damaging Het
Tiam1 C T 16: 89,662,159 (GRCm39) R653H probably damaging Het
Tmc3 T C 7: 83,271,713 (GRCm39) V955A probably benign Het
Tnrc6c G A 11: 117,614,152 (GRCm39) R770H probably damaging Het
Toe1 A T 4: 116,663,308 (GRCm39) N56K probably damaging Het
Tprkb A G 6: 85,905,764 (GRCm39) K150E probably damaging Het
Trps1 T C 15: 50,694,973 (GRCm39) K150E probably damaging Het
Tspyl3 A G 2: 153,066,980 (GRCm39) V86A probably benign Het
Ttc23 T C 7: 67,359,063 (GRCm39) probably benign Het
Ttc36 A T 9: 44,713,094 (GRCm39) probably benign Het
Tubb3 C T 8: 124,138,414 (GRCm39) probably benign Het
Vmn2r68 C T 7: 84,871,088 (GRCm39) V732I probably benign Het
Vps18 A G 2: 119,127,709 (GRCm39) Y844C probably benign Het
Wdr72 T A 9: 74,064,552 (GRCm39) I528N probably damaging Het
Zfp292 C T 4: 34,806,783 (GRCm39) C2087Y possibly damaging Het
Zfp606 T G 7: 12,215,123 (GRCm39) probably benign Het
Zfp933 G A 4: 147,910,927 (GRCm39) A223V probably damaging Het
Zmynd8 G A 2: 165,654,314 (GRCm39) R724* probably null Het
Other mutations in Thbd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Thbd APN 2 148,249,602 (GRCm39) nonsense probably null
IGL01510:Thbd APN 2 148,248,894 (GRCm39) missense probably damaging 1.00
IGL01845:Thbd APN 2 148,249,016 (GRCm39) missense probably benign
IGL01892:Thbd APN 2 148,248,988 (GRCm39) missense possibly damaging 0.68
IGL02039:Thbd APN 2 148,248,462 (GRCm39) missense probably benign 0.05
IGL02261:Thbd APN 2 148,248,401 (GRCm39) missense probably benign
IGL02941:Thbd APN 2 148,248,954 (GRCm39) missense probably damaging 1.00
IGL03110:Thbd APN 2 148,248,716 (GRCm39) missense probably benign
IGL03111:Thbd APN 2 148,248,392 (GRCm39) missense probably benign 0.00
PIT4283001:Thbd UTSW 2 148,249,003 (GRCm39) missense probably benign 0.19
R0102:Thbd UTSW 2 148,248,903 (GRCm39) missense probably damaging 1.00
R0102:Thbd UTSW 2 148,248,903 (GRCm39) missense probably damaging 1.00
R1847:Thbd UTSW 2 148,249,604 (GRCm39) nonsense probably null
R1957:Thbd UTSW 2 148,248,899 (GRCm39) missense probably damaging 0.97
R2320:Thbd UTSW 2 148,248,566 (GRCm39) missense probably damaging 1.00
R2362:Thbd UTSW 2 148,248,284 (GRCm39) missense probably damaging 1.00
R2900:Thbd UTSW 2 148,248,134 (GRCm39) makesense probably null
R3623:Thbd UTSW 2 148,248,893 (GRCm39) missense probably damaging 1.00
R4839:Thbd UTSW 2 148,248,591 (GRCm39) missense probably damaging 1.00
R4936:Thbd UTSW 2 148,249,655 (GRCm39) missense probably damaging 1.00
R5296:Thbd UTSW 2 148,248,903 (GRCm39) missense probably damaging 1.00
R5521:Thbd UTSW 2 148,249,655 (GRCm39) missense probably damaging 1.00
R5677:Thbd UTSW 2 148,249,286 (GRCm39) missense probably damaging 1.00
R6581:Thbd UTSW 2 148,248,192 (GRCm39) missense probably benign
R7139:Thbd UTSW 2 148,248,461 (GRCm39) missense probably benign 0.37
R7246:Thbd UTSW 2 148,248,405 (GRCm39) missense probably benign
R7655:Thbd UTSW 2 148,249,340 (GRCm39) missense probably damaging 1.00
R7656:Thbd UTSW 2 148,249,340 (GRCm39) missense probably damaging 1.00
R7752:Thbd UTSW 2 148,248,894 (GRCm39) missense probably damaging 0.99
R7867:Thbd UTSW 2 148,249,664 (GRCm39) missense probably damaging 1.00
R8398:Thbd UTSW 2 148,248,600 (GRCm39) missense probably benign 0.00
R8429:Thbd UTSW 2 148,249,457 (GRCm39) missense possibly damaging 0.70
R8986:Thbd UTSW 2 148,248,480 (GRCm39) missense probably damaging 1.00
V7582:Thbd UTSW 2 148,249,110 (GRCm39) missense probably benign 0.05
Predicted Primers
Posted On 2014-05-07