Incidental Mutation 'F5770:Vmn2r68'
ID 177992
Institutional Source Beutler Lab
Gene Symbol Vmn2r68
Ensembl Gene ENSMUSG00000096861
Gene Name vomeronasal 2, receptor 68
Synonyms EG620697, Vmn2r68-ps
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # F5770 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 84870726-84886912 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 84871088 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 732 (V732I)
Ref Sequence ENSEMBL: ENSMUSP00000129411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061074]
AlphaFold L7N2B3
Predicted Effect probably benign
Transcript: ENSMUST00000061074
AA Change: V732I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000129411
Gene: ENSMUSG00000096861
AA Change: V732I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 463 4.5e-28 PFAM
Pfam:NCD3G 507 559 1.1e-18 PFAM
Pfam:7tm_3 589 827 3.7e-53 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 99% (96/97)
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,595,050 (GRCm39) H102L possibly damaging Het
Abcb5 T A 12: 118,849,914 (GRCm39) M950L probably benign Het
Ahcy G A 2: 154,906,841 (GRCm39) R151* probably null Het
Arhgef38 T G 3: 132,855,301 (GRCm39) H262P probably damaging Het
Atp6v1h A G 1: 5,194,666 (GRCm39) T282A possibly damaging Het
Camk2g T C 14: 20,789,380 (GRCm39) probably benign Het
Casp8ap2 C T 4: 32,639,944 (GRCm39) H333Y probably benign Het
Cd36 ACTGTCTGT ACTGT 5: 18,025,526 (GRCm39) probably null Het
Cdc42bpb C T 12: 111,262,825 (GRCm39) G1501S probably benign Het
Cfi T A 3: 129,648,641 (GRCm39) I175K possibly damaging Het
Clasp1 G A 1: 118,509,078 (GRCm39) R1027Q probably damaging Het
D630003M21Rik T C 2: 158,042,931 (GRCm39) T870A probably benign Het
Dcaf4 C A 12: 83,584,475 (GRCm39) probably null Het
Dnah12 T A 14: 26,495,050 (GRCm39) N1369K possibly damaging Het
Dnajc22 T A 15: 98,999,363 (GRCm39) Y183N probably damaging Het
Dpyd C T 3: 118,690,775 (GRCm39) Q295* probably null Het
Dync2i1 A C 12: 116,175,460 (GRCm39) S906A possibly damaging Het
Erv3 T C 2: 131,697,846 (GRCm39) H171R possibly damaging Het
Fam221b T C 4: 43,665,865 (GRCm39) T249A probably benign Het
Fbrsl1 C T 5: 110,527,292 (GRCm39) A129T possibly damaging Het
Fcgr1 T C 3: 96,191,592 (GRCm39) *405W probably null Het
Gdap1l1 C T 2: 163,289,406 (GRCm39) probably benign Het
Glrx3 A G 7: 137,060,882 (GRCm39) H172R probably benign Het
Gm10770 T A 2: 150,021,404 (GRCm39) K38* probably null Het
Gm20517 G A 17: 47,929,757 (GRCm39) V65M probably damaging Het
Gm4787 G A 12: 81,424,341 (GRCm39) Q606* probably null Het
Golga4 A G 9: 118,385,143 (GRCm39) E727G possibly damaging Het
Got1 T A 19: 43,489,000 (GRCm39) probably benign Het
Heatr5a A G 12: 51,928,061 (GRCm39) probably benign Het
Hira G A 16: 18,713,571 (GRCm39) A29T probably damaging Het
Hnrnpab A T 11: 51,493,451 (GRCm39) N252K probably benign Het
Ing1 T C 8: 11,611,934 (GRCm39) V124A probably damaging Het
Izumo4 A T 10: 80,539,725 (GRCm39) T155S probably benign Het
Kcnb2 A G 1: 15,780,315 (GRCm39) I396V probably benign Het
Klc1 A T 12: 111,741,006 (GRCm39) I161F probably benign Het
Lpar5 C A 6: 125,058,690 (GRCm39) A137E possibly damaging Het
Lrp4 C T 2: 91,318,863 (GRCm39) S900L possibly damaging Het
Lrrc37a T G 11: 103,346,338 (GRCm39) N3176T possibly damaging Het
Mbd5 A G 2: 49,206,422 (GRCm39) D1713G probably damaging Het
Mctp2 T A 7: 71,771,499 (GRCm39) probably benign Het
Muc6 T G 7: 141,233,880 (GRCm39) E808A probably benign Het
Mylk G T 16: 34,815,574 (GRCm39) probably null Het
Myrfl T C 10: 116,697,435 (GRCm39) T30A probably damaging Het
Nbeal2 A G 9: 110,467,005 (GRCm39) V670A possibly damaging Het
Nphp3 T C 9: 103,913,093 (GRCm39) probably null Het
Numbl T C 7: 26,979,027 (GRCm39) S379P probably benign Het
Or10j7 G T 1: 173,011,531 (GRCm39) L157I probably benign Het
Or5an6 G A 19: 12,371,914 (GRCm39) V96I probably benign Het
Or5p57 G T 7: 107,665,885 (GRCm39) T40K probably benign Het
Otop3 T A 11: 115,235,664 (GRCm39) L432Q probably damaging Het
Papln C T 12: 83,825,608 (GRCm39) R608C possibly damaging Het
Pelp1 T A 11: 70,288,976 (GRCm39) T257S probably damaging Het
Pigx T C 16: 31,906,240 (GRCm39) D129G probably damaging Het
Pik3cd A C 4: 149,741,776 (GRCm39) L390R probably damaging Het
Plekhb1 T C 7: 100,303,825 (GRCm39) T112A probably benign Het
Ppwd1 A G 13: 104,356,745 (GRCm39) Y257H probably damaging Het
Prkcb G T 7: 122,127,699 (GRCm39) W274C probably damaging Het
Rabep1 T C 11: 70,828,342 (GRCm39) probably benign Het
Ralgapa1 G A 12: 55,842,438 (GRCm39) probably benign Het
Rasa1 A G 13: 85,375,064 (GRCm39) probably null Het
Rbbp8nl T A 2: 179,920,001 (GRCm39) T558S probably benign Het
Recql4 T C 15: 76,590,369 (GRCm39) D705G possibly damaging Het
Ror1 A G 4: 100,298,130 (GRCm39) Q501R probably damaging Het
Rundc3b TGCCGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGCCGC 5: 8,672,549 (GRCm39) probably benign Het
Sirpb1b A G 3: 15,568,243 (GRCm39) V366A probably benign Het
Slc30a4 T A 2: 122,531,458 (GRCm39) M136L probably benign Het
Slc5a6 C T 5: 31,199,957 (GRCm39) probably null Het
Spaca1 T C 4: 34,039,311 (GRCm39) E192G probably damaging Het
Spata31 C A 13: 65,069,462 (GRCm39) P537T probably benign Het
Sptbn2 C T 19: 4,800,660 (GRCm39) R2292C probably damaging Het
Thbd A T 2: 148,249,110 (GRCm39) Y253N probably benign Het
Tiam1 C T 16: 89,662,159 (GRCm39) R653H probably damaging Het
Tmc3 T C 7: 83,271,713 (GRCm39) V955A probably benign Het
Tnrc6c G A 11: 117,614,152 (GRCm39) R770H probably damaging Het
Toe1 A T 4: 116,663,308 (GRCm39) N56K probably damaging Het
Tprkb A G 6: 85,905,764 (GRCm39) K150E probably damaging Het
Trps1 T C 15: 50,694,973 (GRCm39) K150E probably damaging Het
Tspyl3 A G 2: 153,066,980 (GRCm39) V86A probably benign Het
Ttc23 T C 7: 67,359,063 (GRCm39) probably benign Het
Ttc36 A T 9: 44,713,094 (GRCm39) probably benign Het
Tubb3 C T 8: 124,138,414 (GRCm39) probably benign Het
Vps18 A G 2: 119,127,709 (GRCm39) Y844C probably benign Het
Wdr72 T A 9: 74,064,552 (GRCm39) I528N probably damaging Het
Zfp292 C T 4: 34,806,783 (GRCm39) C2087Y possibly damaging Het
Zfp606 T G 7: 12,215,123 (GRCm39) probably benign Het
Zfp933 G A 4: 147,910,927 (GRCm39) A223V probably damaging Het
Zmynd8 G A 2: 165,654,314 (GRCm39) R724* probably null Het
Other mutations in Vmn2r68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Vmn2r68 APN 7 84,886,819 (GRCm39) missense probably benign
IGL01477:Vmn2r68 APN 7 84,882,691 (GRCm39) missense probably damaging 1.00
IGL01600:Vmn2r68 APN 7 84,871,468 (GRCm39) missense probably benign 0.39
IGL01979:Vmn2r68 APN 7 84,871,325 (GRCm39) missense probably benign
IGL01999:Vmn2r68 APN 7 84,871,439 (GRCm39) missense probably damaging 1.00
IGL02269:Vmn2r68 APN 7 84,870,947 (GRCm39) missense possibly damaging 0.84
IGL02517:Vmn2r68 APN 7 84,871,153 (GRCm39) nonsense probably null
IGL02827:Vmn2r68 APN 7 84,886,800 (GRCm39) missense probably damaging 1.00
IGL02852:Vmn2r68 APN 7 84,882,595 (GRCm39) missense probably damaging 1.00
IGL02982:Vmn2r68 APN 7 84,883,649 (GRCm39) missense probably benign 0.12
IGL03099:Vmn2r68 APN 7 84,871,448 (GRCm39) nonsense probably null
IGL03166:Vmn2r68 APN 7 84,871,331 (GRCm39) missense probably benign 0.01
IGL03168:Vmn2r68 APN 7 84,870,972 (GRCm39) missense probably damaging 1.00
IGL03243:Vmn2r68 APN 7 84,882,963 (GRCm39) missense possibly damaging 0.66
R0280:Vmn2r68 UTSW 7 84,882,466 (GRCm39) critical splice donor site probably null
R0280:Vmn2r68 UTSW 7 84,882,457 (GRCm39) splice site probably benign
R0281:Vmn2r68 UTSW 7 84,882,466 (GRCm39) critical splice donor site probably null
R0281:Vmn2r68 UTSW 7 84,882,457 (GRCm39) splice site probably benign
R0348:Vmn2r68 UTSW 7 84,870,884 (GRCm39) missense possibly damaging 0.50
R0390:Vmn2r68 UTSW 7 84,882,466 (GRCm39) critical splice donor site probably null
R0390:Vmn2r68 UTSW 7 84,882,457 (GRCm39) splice site probably benign
R0722:Vmn2r68 UTSW 7 84,870,794 (GRCm39) missense possibly damaging 0.95
R1129:Vmn2r68 UTSW 7 84,886,712 (GRCm39) splice site probably null
R1136:Vmn2r68 UTSW 7 84,871,549 (GRCm39) missense possibly damaging 0.81
R1319:Vmn2r68 UTSW 7 84,881,700 (GRCm39) missense probably damaging 0.96
R1614:Vmn2r68 UTSW 7 84,870,946 (GRCm39) missense possibly damaging 0.93
R1682:Vmn2r68 UTSW 7 84,882,574 (GRCm39) missense possibly damaging 0.68
R1837:Vmn2r68 UTSW 7 84,882,886 (GRCm39) missense probably damaging 0.96
R1893:Vmn2r68 UTSW 7 84,883,867 (GRCm39) nonsense probably null
R1908:Vmn2r68 UTSW 7 84,883,260 (GRCm39) missense probably benign 0.09
R1909:Vmn2r68 UTSW 7 84,883,260 (GRCm39) missense probably benign 0.09
R1951:Vmn2r68 UTSW 7 84,883,102 (GRCm39) missense probably damaging 1.00
R2177:Vmn2r68 UTSW 7 84,871,123 (GRCm39) missense probably benign 0.01
R2178:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R2185:Vmn2r68 UTSW 7 84,882,901 (GRCm39) nonsense probably null
R2188:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R2282:Vmn2r68 UTSW 7 84,870,859 (GRCm39) missense possibly damaging 0.65
R2567:Vmn2r68 UTSW 7 84,883,803 (GRCm39) missense probably benign
R2869:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2869:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2870:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2870:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2871:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2871:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2873:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2874:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R3149:Vmn2r68 UTSW 7 84,886,875 (GRCm39) missense probably benign 0.00
R3401:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R3978:Vmn2r68 UTSW 7 84,881,670 (GRCm39) missense probably benign 0.00
R4399:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R4401:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R4421:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R4478:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R4479:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R4495:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R4628:Vmn2r68 UTSW 7 84,883,673 (GRCm39) missense probably benign 0.00
R4649:Vmn2r68 UTSW 7 84,870,743 (GRCm39) missense probably benign
R4654:Vmn2r68 UTSW 7 84,882,769 (GRCm39) nonsense probably null
R4793:Vmn2r68 UTSW 7 84,883,648 (GRCm39) missense probably benign 0.01
R5007:Vmn2r68 UTSW 7 84,881,622 (GRCm39) missense probably benign
R5021:Vmn2r68 UTSW 7 84,882,942 (GRCm39) missense possibly damaging 0.62
R5082:Vmn2r68 UTSW 7 84,883,076 (GRCm39) missense probably benign 0.12
R5177:Vmn2r68 UTSW 7 84,871,199 (GRCm39) missense probably damaging 0.99
R5221:Vmn2r68 UTSW 7 84,871,085 (GRCm39) missense probably damaging 1.00
R5514:Vmn2r68 UTSW 7 84,886,767 (GRCm39) missense possibly damaging 0.92
R5521:Vmn2r68 UTSW 7 84,882,926 (GRCm39) missense probably benign 0.03
R5563:Vmn2r68 UTSW 7 84,871,283 (GRCm39) missense probably damaging 1.00
R5664:Vmn2r68 UTSW 7 84,882,978 (GRCm39) missense probably benign 0.02
R5829:Vmn2r68 UTSW 7 84,886,812 (GRCm39) missense probably benign 0.00
R6016:Vmn2r68 UTSW 7 84,871,453 (GRCm39) missense probably damaging 0.99
R6356:Vmn2r68 UTSW 7 84,883,048 (GRCm39) missense possibly damaging 0.85
R6413:Vmn2r68 UTSW 7 84,870,973 (GRCm39) missense probably damaging 1.00
R6418:Vmn2r68 UTSW 7 84,882,915 (GRCm39) missense probably benign
R6699:Vmn2r68 UTSW 7 84,881,583 (GRCm39) missense possibly damaging 0.58
R7287:Vmn2r68 UTSW 7 84,871,460 (GRCm39) missense probably benign 0.33
R7319:Vmn2r68 UTSW 7 84,883,042 (GRCm39) missense probably benign
R7374:Vmn2r68 UTSW 7 84,881,607 (GRCm39) missense possibly damaging 0.66
R7585:Vmn2r68 UTSW 7 84,881,587 (GRCm39) missense probably damaging 1.00
R7605:Vmn2r68 UTSW 7 84,883,116 (GRCm39) missense probably benign 0.01
R7892:Vmn2r68 UTSW 7 84,883,722 (GRCm39) missense probably benign
R7979:Vmn2r68 UTSW 7 84,883,625 (GRCm39) critical splice donor site probably null
R8177:Vmn2r68 UTSW 7 84,871,422 (GRCm39) nonsense probably null
R8349:Vmn2r68 UTSW 7 84,882,785 (GRCm39) missense probably damaging 1.00
R8378:Vmn2r68 UTSW 7 84,871,108 (GRCm39) missense probably benign 0.00
R8397:Vmn2r68 UTSW 7 84,886,722 (GRCm39) missense possibly damaging 0.71
R8449:Vmn2r68 UTSW 7 84,882,785 (GRCm39) missense probably damaging 1.00
R8543:Vmn2r68 UTSW 7 84,883,648 (GRCm39) missense probably benign 0.01
R8680:Vmn2r68 UTSW 7 84,871,321 (GRCm39) missense possibly damaging 0.68
R9056:Vmn2r68 UTSW 7 84,871,420 (GRCm39) missense possibly damaging 0.71
R9342:Vmn2r68 UTSW 7 84,882,993 (GRCm39) missense probably benign 0.39
R9734:Vmn2r68 UTSW 7 84,882,757 (GRCm39) missense possibly damaging 0.54
V7581:Vmn2r68 UTSW 7 84,871,088 (GRCm39) missense probably benign 0.01
Z1176:Vmn2r68 UTSW 7 84,871,289 (GRCm39) missense probably benign 0.27
Z1176:Vmn2r68 UTSW 7 84,870,941 (GRCm39) missense probably damaging 1.00
Z1176:Vmn2r68 UTSW 7 84,871,307 (GRCm39) missense possibly damaging 0.92
Predicted Primers
Posted On 2014-05-07