Mutagenetix > Incidental Mutation

Incidental Mutation 'F5770:Prkcb'

177995

Institutional Source

Beutler Lab

Gene Symbol

Prkcb

Ensembl Gene

ENSMUSG00000052889

Gene Name

protein kinase C, beta

Synonyms

Pkcb, Prkcb2, Prkcb1, A130082F03Rik, PKC-Beta

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

F5770 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

122288751-122634402 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 122528476 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Cysteine at position 274 (W274C)

Ref Sequence

ENSEMBL: ENSMUSP00000138788 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064921] [ENSMUST00000064989] [ENSMUST00000143692]

AlphaFold

P68404

Predicted Effect

probably damaging
Transcript: ENSMUST00000064921
AA Change: W274C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000064812
Gene: ENSMUSG00000052889
AA Change: W274C

Domain	Start	End	E-Value	Type
low complexity region	4	16	N/A	INTRINSIC
C1	37	86	7.11e-16	SMART
C1	102	151	1.42e-15	SMART
C2	172	275	1.05e-23	SMART
S_TKc	342	600	4.36e-97	SMART
S_TK_X	601	664	9.86e-27	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000064989
AA Change: W274C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000070019
Gene: ENSMUSG00000052889
AA Change: W274C

Domain	Start	End	E-Value	Type
low complexity region	4	16	N/A	INTRINSIC
C1	37	86	7.11e-16	SMART
C1	102	151	1.42e-15	SMART
C2	172	275	1.05e-23	SMART
S_TKc	342	600	4.36e-97	SMART
S_TK_X	601	663	6.27e-20	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000143692
AA Change: W274C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000138788
Gene: ENSMUSG00000052889
AA Change: W274C

Domain	Start	End	E-Value	Type
low complexity region	4	16	N/A	INTRINSIC
C1	37	86	7.11e-16	SMART
C1	102	151	1.42e-15	SMART
C2	172	275	1.05e-23	SMART
S_TKc	342	600	4.36e-97	SMART
S_TK_X	601	663	6.27e-20	SMART

Meta Mutation Damage Score

0.9251

Coding Region Coverage

1x: 0.0%
3x: 0.0%
10x: 0.0%
20x: 0.0%

Validation Efficiency

99% (96/97)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This protein kinase has been reported to be involved in many different cellular functions, such as B cell activation, apoptosis induction, endothelial cell proliferation, and intestinal sugar absorption. Studies in mice also suggest that this kinase may also regulate neuronal functions and correlate fear-induced conflict behavior after stress. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired humoral immune responses, altered proliferative responses of B cells to various stimuli, abnormal vascular wound healing, and deficits in contextual and cued fear conditioning. ENU-induced mutations leadto impaired T cell-independent IgM responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530002B09Rik	A	T	4: 122,701,257	H102L	possibly damaging	Het
Abcb5	T	A	12: 118,886,179	M950L	probably benign	Het
AC139131.1	T	G	7: 12,481,196		probably benign	Het
Ahcy	G	A	2: 155,064,921	R151*	probably null	Het
Arhgef38	T	G	3: 133,149,540	H262P	probably damaging	Het
Atp6v1h	A	G	1: 5,124,443	T282A	possibly damaging	Het
Camk2g	T	C	14: 20,739,312		probably benign	Het
Casp8ap2	C	T	4: 32,639,944	H333Y	probably benign	Het
Cd36	ACTGTCTGT	ACTGT	5: 17,820,528		probably null	Het
Cdc42bpb	C	T	12: 111,296,391	G1501S	probably benign	Het
Cfi	T	A	3: 129,854,992	I175K	possibly damaging	Het
Clasp1	G	A	1: 118,581,348	R1027Q	probably damaging	Het
D630003M21Rik	T	C	2: 158,201,011	T870A	probably benign	Het
Dcaf4	C	A	12: 83,537,701		probably null	Het
Dnah12	T	A	14: 26,773,093	N1369K	possibly damaging	Het
Dnajc22	T	A	15: 99,101,482	Y183N	probably damaging	Het
Dpyd	C	T	3: 118,897,126	Q295*	probably null	Het
Erv3	T	C	2: 131,855,926	H171R	possibly damaging	Het
Fam221b	T	C	4: 43,665,865	T249A	probably benign	Het
Fbrsl1	C	T	5: 110,379,426	A129T	possibly damaging	Het
Fcgr1	T	C	3: 96,284,276	*405W	probably null	Het
Gdap1l1	C	T	2: 163,447,486		probably benign	Het
Glrx3	A	G	7: 137,459,153	H172R	probably benign	Het
Gm10770	T	A	2: 150,179,484	K38*	probably null	Het
Gm20517	G	A	17: 47,618,832	V65M	probably damaging	Het
Gm4787	G	A	12: 81,377,567	Q606*	probably null	Het
Golga4	A	G	9: 118,556,075	E727G	possibly damaging	Het
Got1	T	A	19: 43,500,561		probably benign	Het
Heatr5a	A	G	12: 51,881,278		probably benign	Het
Hira	G	A	16: 18,894,821	A29T	probably damaging	Het
Hnrnpab	A	T	11: 51,602,624	N252K	probably benign	Het
Ing1	T	C	8: 11,561,934	V124A	probably damaging	Het
Izumo4	A	T	10: 80,703,891	T155S	probably benign	Het
Kcnb2	A	G	1: 15,710,091	I396V	probably benign	Het
Klc1	A	T	12: 111,774,572	I161F	probably benign	Het
Lpar5	C	A	6: 125,081,727	A137E	possibly damaging	Het
Lrp4	C	T	2: 91,488,518	S900L	possibly damaging	Het
Lrrc37a	T	G	11: 103,455,512	N3176T	possibly damaging	Het
Mbd5	A	G	2: 49,316,410	D1713G	probably damaging	Het
Mctp2	T	A	7: 72,121,751		probably benign	Het
Muc6	T	G	7: 141,647,613	E808A	probably benign	Het
Mylk	G	T	16: 34,995,204		probably null	Het
Myrfl	T	C	10: 116,861,530	T30A	probably damaging	Het
Nbeal2	A	G	9: 110,637,937	V670A	possibly damaging	Het
Nphp3	T	C	9: 104,035,894		probably null	Het
Numbl	T	C	7: 27,279,602	S379P	probably benign	Het
Olfr1406	G	T	1: 173,183,964	L157I	probably benign	Het
Olfr1440	G	A	19: 12,394,550	V96I	probably benign	Het
Olfr480	G	T	7: 108,066,678	T40K	probably benign	Het
Otop3	T	A	11: 115,344,838	L432Q	probably damaging	Het
Papln	C	T	12: 83,778,834	R608C	possibly damaging	Het
Pelp1	T	A	11: 70,398,150	T257S	probably damaging	Het
Pigx	T	C	16: 32,087,422	D129G	probably damaging	Het
Pik3cd	A	C	4: 149,657,319	L390R	probably damaging	Het
Plekhb1	T	C	7: 100,654,618	T112A	probably benign	Het
Ppwd1	A	G	13: 104,220,237	Y257H	probably damaging	Het
Rabep1	T	C	11: 70,937,516		probably benign	Het
Ralgapa1	G	A	12: 55,795,653		probably benign	Het
Rasa1	A	G	13: 85,226,945		probably null	Het
Rbbp8nl	T	A	2: 180,278,208	T558S	probably benign	Het
Recql4	T	C	15: 76,706,169	D705G	possibly damaging	Het
Ror1	A	G	4: 100,440,933	Q501R	probably damaging	Het
Rundc3b	TGCCGCCGCCGCCGCCGCCGCCGCCGC	TGCCGCCGCCGCCGCCGCCGCCGC	5: 8,622,549		probably benign	Het
Sirpb1b	A	G	3: 15,503,183	V366A	probably benign	Het
Slc30a4	T	A	2: 122,689,538	M136L	probably benign	Het
Slc5a6	C	T	5: 31,042,613		probably null	Het
Spaca1	T	C	4: 34,039,311	E192G	probably damaging	Het
Spata31	C	A	13: 64,921,648	P537T	probably benign	Het
Sptbn2	C	T	19: 4,750,632	R2292C	probably damaging	Het
Thbd	A	T	2: 148,407,190	Y253N	probably benign	Het
Tiam1	C	T	16: 89,865,271	R653H	probably damaging	Het
Tmc3	T	C	7: 83,622,505	V955A	probably benign	Het
Tnrc6c	G	A	11: 117,723,326	R770H	probably damaging	Het
Toe1	A	T	4: 116,806,111	N56K	probably damaging	Het
Tprkb	A	G	6: 85,928,782	K150E	probably damaging	Het
Trps1	T	C	15: 50,831,577	K150E	probably damaging	Het
Tspyl3	A	G	2: 153,225,060	V86A	probably benign	Het
Ttc23	T	C	7: 67,709,315		probably benign	Het
Ttc36	A	T	9: 44,801,797		probably benign	Het
Tubb3	C	T	8: 123,411,675		probably benign	Het
Vmn2r68	C	T	7: 85,221,880	V732I	probably benign	Het
Vps18	A	G	2: 119,297,228	Y844C	probably benign	Het
Wdr60	A	C	12: 116,211,840	S906A	possibly damaging	Het
Wdr72	T	A	9: 74,157,270	I528N	probably damaging	Het
Zfp292	C	T	4: 34,806,783	C2087Y	possibly damaging	Het
Zfp933	G	A	4: 147,826,470	A223V	probably damaging	Het
Zmynd8	G	A	2: 165,812,394	R724*	probably null	Het

Other mutations in Prkcb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
tilcara	APN	7	122595005	missense	probably damaging	1.00
IGL02045:Prkcb	APN	7	122590167	missense	probably damaging	1.00
IGL02273:Prkcb	APN	7	122627767	missense	probably damaging	1.00
IGL02638:Prkcb	APN	7	122600840	splice site	probably benign
IGL02962:Prkcb	APN	7	122425047	splice site	probably null
IGL03013:Prkcb	APN	7	122627682	missense	probably damaging	1.00
IGL03224:Prkcb	APN	7	122516924	nonsense	probably null
Almonde	UTSW	7	122582449	missense	probably damaging	1.00
Baghdad	UTSW	7	122627663	missense	probably benign	0.07
Mesopotamia	UTSW	7	122289514	missense	probably damaging	1.00
Mosul	UTSW	7	122516844	missense	probably damaging	1.00
tigris	UTSW	7	122424977	missense	probably damaging	1.00
Tikrit	UTSW	7	122627693	missense	probably damaging	1.00
untied	UTSW	7	122582439	missense	possibly damaging	0.90
R0078:Prkcb	UTSW	7	122590170	missense	probably damaging	1.00
R0409:Prkcb	UTSW	7	122424977	missense	probably damaging	1.00
R0660:Prkcb	UTSW	7	122424959	missense	possibly damaging	0.56
R1462:Prkcb	UTSW	7	122582449	missense	probably damaging	1.00
R1462:Prkcb	UTSW	7	122582449	missense	probably damaging	1.00
R1480:Prkcb	UTSW	7	122594642	missense	probably damaging	1.00
R1518:Prkcb	UTSW	7	122544631	critical splice acceptor site	probably null
R1540:Prkcb	UTSW	7	122627693	missense	probably damaging	1.00
R1860:Prkcb	UTSW	7	122568201	missense	probably damaging	1.00
R3110:Prkcb	UTSW	7	122516856	missense	probably damaging	0.99
R3112:Prkcb	UTSW	7	122516856	missense	probably damaging	0.99
R4583:Prkcb	UTSW	7	122457224	missense	probably benign	0.32
R4847:Prkcb	UTSW	7	122568149	missense	probably benign	0.35
R5220:Prkcb	UTSW	7	122289455	missense	probably damaging	1.00
R5487:Prkcb	UTSW	7	122600725	nonsense	probably null
R5599:Prkcb	UTSW	7	122582478	missense	probably benign	0.17
R5946:Prkcb	UTSW	7	122544703	missense	probably benign
R6257:Prkcb	UTSW	7	122568163	missense	probably benign
R6590:Prkcb	UTSW	7	122289514	missense	probably damaging	1.00
R6618:Prkcb	UTSW	7	122627663	missense	probably benign	0.07
R6690:Prkcb	UTSW	7	122289514	missense	probably damaging	1.00
R6763:Prkcb	UTSW	7	122594664	missense	probably damaging	1.00
R7289:Prkcb	UTSW	7	122544687	missense	probably benign	0.04
R7414:Prkcb	UTSW	7	122568227	missense	possibly damaging	0.83
R7466:Prkcb	UTSW	7	122516844	missense	probably damaging	1.00
R7540:Prkcb	UTSW	7	122568134	missense	probably damaging	0.99
R8283:Prkcb	UTSW	7	122600725	nonsense	probably null
R9072:Prkcb	UTSW	7	122528548	missense	probably benign	0.14
R9483:Prkcb	UTSW	7	122582440	missense	probably damaging	0.99
R9670:Prkcb	UTSW	7	122633847	nonsense	probably null
V7581:Prkcb	UTSW	7	122528476	missense	probably damaging	0.99
X0061:Prkcb	UTSW	7	122457306	missense	probably benign	0.03
Z1177:Prkcb	UTSW	7	122568196	missense	possibly damaging	0.90

Predicted Primers

Posted On

2014-05-07