Incidental Mutation 'F5770:Prkcb'
ID177995
Institutional Source Beutler Lab
Gene Symbol Prkcb
Ensembl Gene ENSMUSG00000052889
Gene Nameprotein kinase C, beta
SynonymsPkcb, Prkcb2, Prkcb1, A130082F03Rik, PKC-Beta
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #F5770 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location122288751-122634402 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 122528476 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Cysteine at position 274 (W274C)
Ref Sequence ENSEMBL: ENSMUSP00000138788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064921] [ENSMUST00000064989] [ENSMUST00000143692]
Predicted Effect probably damaging
Transcript: ENSMUST00000064921
AA Change: W274C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000064812
Gene: ENSMUSG00000052889
AA Change: W274C

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
C1 37 86 7.11e-16 SMART
C1 102 151 1.42e-15 SMART
C2 172 275 1.05e-23 SMART
S_TKc 342 600 4.36e-97 SMART
S_TK_X 601 664 9.86e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000064989
AA Change: W274C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000070019
Gene: ENSMUSG00000052889
AA Change: W274C

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
C1 37 86 7.11e-16 SMART
C1 102 151 1.42e-15 SMART
C2 172 275 1.05e-23 SMART
S_TKc 342 600 4.36e-97 SMART
S_TK_X 601 663 6.27e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000143692
AA Change: W274C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138788
Gene: ENSMUSG00000052889
AA Change: W274C

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
C1 37 86 7.11e-16 SMART
C1 102 151 1.42e-15 SMART
C2 172 275 1.05e-23 SMART
S_TKc 342 600 4.36e-97 SMART
S_TK_X 601 663 6.27e-20 SMART
Meta Mutation Damage Score 0.9251 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 99% (96/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This protein kinase has been reported to be involved in many different cellular functions, such as B cell activation, apoptosis induction, endothelial cell proliferation, and intestinal sugar absorption. Studies in mice also suggest that this kinase may also regulate neuronal functions and correlate fear-induced conflict behavior after stress. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired humoral immune responses, altered proliferative responses of B cells to various stimuli, abnormal vascular wound healing, and deficits in contextual and cued fear conditioning. ENU-induced mutations leadto impaired T cell-independent IgM responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,701,257 H102L possibly damaging Het
Abcb5 T A 12: 118,886,179 M950L probably benign Het
AC139131.1 T G 7: 12,481,196 probably benign Het
Ahcy G A 2: 155,064,921 R151* probably null Het
Arhgef38 T G 3: 133,149,540 H262P probably damaging Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Camk2g T C 14: 20,739,312 probably benign Het
Casp8ap2 C T 4: 32,639,944 H333Y probably benign Het
Cd36 ACTGTCTGT ACTGT 5: 17,820,528 probably null Het
Cdc42bpb C T 12: 111,296,391 G1501S probably benign Het
Cfi T A 3: 129,854,992 I175K possibly damaging Het
Clasp1 G A 1: 118,581,348 R1027Q probably damaging Het
D630003M21Rik T C 2: 158,201,011 T870A probably benign Het
Dcaf4 C A 12: 83,537,701 probably null Het
Dnah12 T A 14: 26,773,093 N1369K possibly damaging Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Dpyd C T 3: 118,897,126 Q295* probably null Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Fbrsl1 C T 5: 110,379,426 A129T possibly damaging Het
Fcgr1 T C 3: 96,284,276 *405W probably null Het
Gdap1l1 C T 2: 163,447,486 probably benign Het
Glrx3 A G 7: 137,459,153 H172R probably benign Het
Gm10770 T A 2: 150,179,484 K38* probably null Het
Gm20517 G A 17: 47,618,832 V65M probably damaging Het
Gm4787 G A 12: 81,377,567 Q606* probably null Het
Golga4 A G 9: 118,556,075 E727G possibly damaging Het
Got1 T A 19: 43,500,561 probably benign Het
Heatr5a A G 12: 51,881,278 probably benign Het
Hira G A 16: 18,894,821 A29T probably damaging Het
Hnrnpab A T 11: 51,602,624 N252K probably benign Het
Ing1 T C 8: 11,561,934 V124A probably damaging Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Klc1 A T 12: 111,774,572 I161F probably benign Het
Lpar5 C A 6: 125,081,727 A137E possibly damaging Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Lrrc37a T G 11: 103,455,512 N3176T possibly damaging Het
Mbd5 A G 2: 49,316,410 D1713G probably damaging Het
Mctp2 T A 7: 72,121,751 probably benign Het
Muc6 T G 7: 141,647,613 E808A probably benign Het
Mylk G T 16: 34,995,204 probably null Het
Myrfl T C 10: 116,861,530 T30A probably damaging Het
Nbeal2 A G 9: 110,637,937 V670A possibly damaging Het
Nphp3 T C 9: 104,035,894 probably null Het
Numbl T C 7: 27,279,602 S379P probably benign Het
Olfr1406 G T 1: 173,183,964 L157I probably benign Het
Olfr1440 G A 19: 12,394,550 V96I probably benign Het
Olfr480 G T 7: 108,066,678 T40K probably benign Het
Otop3 T A 11: 115,344,838 L432Q probably damaging Het
Papln C T 12: 83,778,834 R608C possibly damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pigx T C 16: 32,087,422 D129G probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T C 7: 100,654,618 T112A probably benign Het
Ppwd1 A G 13: 104,220,237 Y257H probably damaging Het
Rabep1 T C 11: 70,937,516 probably benign Het
Ralgapa1 G A 12: 55,795,653 probably benign Het
Rasa1 A G 13: 85,226,945 probably null Het
Rbbp8nl T A 2: 180,278,208 T558S probably benign Het
Recql4 T C 15: 76,706,169 D705G possibly damaging Het
Ror1 A G 4: 100,440,933 Q501R probably damaging Het
Rundc3b TGCCGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGCCGC 5: 8,622,549 probably benign Het
Sirpb1b A G 3: 15,503,183 V366A probably benign Het
Slc30a4 T A 2: 122,689,538 M136L probably benign Het
Slc5a6 C T 5: 31,042,613 probably null Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Spata31 C A 13: 64,921,648 P537T probably benign Het
Sptbn2 C T 19: 4,750,632 R2292C probably damaging Het
Thbd A T 2: 148,407,190 Y253N probably benign Het
Tiam1 C T 16: 89,865,271 R653H probably damaging Het
Tmc3 T C 7: 83,622,505 V955A probably benign Het
Tnrc6c G A 11: 117,723,326 R770H probably damaging Het
Toe1 A T 4: 116,806,111 N56K probably damaging Het
Tprkb A G 6: 85,928,782 K150E probably damaging Het
Trps1 T C 15: 50,831,577 K150E probably damaging Het
Tspyl3 A G 2: 153,225,060 V86A probably benign Het
Ttc23 T C 7: 67,709,315 probably benign Het
Ttc36 A T 9: 44,801,797 probably benign Het
Tubb3 C T 8: 123,411,675 probably benign Het
Vmn2r68 C T 7: 85,221,880 V732I probably benign Het
Vps18 A G 2: 119,297,228 Y844C probably benign Het
Wdr60 A C 12: 116,211,840 S906A possibly damaging Het
Wdr72 T A 9: 74,157,270 I528N probably damaging Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zfp933 G A 4: 147,826,470 A223V probably damaging Het
Zmynd8 G A 2: 165,812,394 R724* probably null Het
Other mutations in Prkcb
AlleleSourceChrCoordTypePredicted EffectPPH Score
tilcara APN 7 122595005 missense probably damaging 1.00
IGL02045:Prkcb APN 7 122590167 missense probably damaging 1.00
IGL02273:Prkcb APN 7 122627767 missense probably damaging 1.00
IGL02638:Prkcb APN 7 122600840 splice site probably benign
IGL02962:Prkcb APN 7 122425047 splice site probably null
IGL03013:Prkcb APN 7 122627682 missense probably damaging 1.00
IGL03224:Prkcb APN 7 122516924 nonsense probably null
Almonde UTSW 7 122582449 missense probably damaging 1.00
Baghdad UTSW 7 122627663 missense probably benign 0.07
Mesopotamia UTSW 7 122289514 missense probably damaging 1.00
tigris UTSW 7 122424977 missense probably damaging 1.00
Tikrit UTSW 7 122627693 missense probably damaging 1.00
untied UTSW 7 122582439 missense possibly damaging 0.90
R0078:Prkcb UTSW 7 122590170 missense probably damaging 1.00
R0409:Prkcb UTSW 7 122424977 missense probably damaging 1.00
R0660:Prkcb UTSW 7 122424959 missense possibly damaging 0.56
R1462:Prkcb UTSW 7 122582449 missense probably damaging 1.00
R1462:Prkcb UTSW 7 122582449 missense probably damaging 1.00
R1480:Prkcb UTSW 7 122594642 missense probably damaging 1.00
R1518:Prkcb UTSW 7 122544631 critical splice acceptor site probably null
R1540:Prkcb UTSW 7 122627693 missense probably damaging 1.00
R1860:Prkcb UTSW 7 122568201 missense probably damaging 1.00
R3110:Prkcb UTSW 7 122516856 missense probably damaging 0.99
R3112:Prkcb UTSW 7 122516856 missense probably damaging 0.99
R4583:Prkcb UTSW 7 122457224 missense probably benign 0.32
R4847:Prkcb UTSW 7 122568149 missense probably benign 0.35
R5220:Prkcb UTSW 7 122289455 missense probably damaging 1.00
R5487:Prkcb UTSW 7 122600725 nonsense probably null
R5599:Prkcb UTSW 7 122582478 missense probably benign 0.17
R5946:Prkcb UTSW 7 122544703 missense probably benign
R6257:Prkcb UTSW 7 122568163 missense probably benign
R6590:Prkcb UTSW 7 122289514 missense probably damaging 1.00
R6618:Prkcb UTSW 7 122627663 missense probably benign 0.07
R6690:Prkcb UTSW 7 122289514 missense probably damaging 1.00
R6763:Prkcb UTSW 7 122594664 missense probably damaging 1.00
R7289:Prkcb UTSW 7 122544687 missense probably benign 0.04
R7414:Prkcb UTSW 7 122568227 missense possibly damaging 0.83
R7466:Prkcb UTSW 7 122516844 missense probably damaging 1.00
R7540:Prkcb UTSW 7 122568134 missense probably damaging 0.99
V7581:Prkcb UTSW 7 122528476 missense probably damaging 0.99
X0061:Prkcb UTSW 7 122457306 missense probably benign 0.03
Z1177:Prkcb UTSW 7 122568196 missense not run
Predicted Primers
Posted On2014-05-07