Incidental Mutation 'R0023:Hikeshi'
ID178047
Institutional Source Beutler Lab
Gene Symbol Hikeshi
Ensembl Gene ENSMUSG00000062797
Gene Nameheat shock protein nuclear import factor
Synonyms0610007P06Rik, Hikeshi, l(7)6Rn, 1110002N09Rik, l7Rn6
MMRRC Submission 038318-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0023 (G1)
Quality Score59
Status Validated
Chromosome7
Chromosomal Location89917529-89941204 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 89920204 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075010] [ENSMUST00000078918] [ENSMUST00000117354] [ENSMUST00000130609] [ENSMUST00000153470] [ENSMUST00000207309]
Predicted Effect probably benign
Transcript: ENSMUST00000075010
SMART Domains Protein: ENSMUSP00000102856
Gene: ENSMUSG00000062797

DomainStartEndE-ValueType
Pfam:DUF775 1 156 5.4e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078918
SMART Domains Protein: ENSMUSP00000077951
Gene: ENSMUSG00000062797

DomainStartEndE-ValueType
Pfam:DUF775 1 89 3e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117354
SMART Domains Protein: ENSMUSP00000112750
Gene: ENSMUSG00000062797

DomainStartEndE-ValueType
Pfam:DUF775 2 96 9.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130609
Predicted Effect probably benign
Transcript: ENSMUST00000150740
Predicted Effect probably benign
Transcript: ENSMUST00000153470
SMART Domains Protein: ENSMUSP00000119806
Gene: ENSMUSG00000062797

DomainStartEndE-ValueType
Pfam:DUF775 1 195 2.3e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208357
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an evolutionarily conserved nuclear transport receptor that mediates heat-shock-induced nuclear import of 70 kDa heat-shock proteins (Hsp70s) through interactions with FG-nucleoporins. The protein mediates transport of the ATP form but not the ADP form of Hsp70 proteins under conditions of heat shock stress. Structural analyses demonstrate that the protein forms an asymmetric homodimer and that the N-terminal domain consists of a jelly-roll/beta-sandwich fold structure that contains hydrophobic pockets involved in FG-nucleoporin recognition. Reduction of RNA expression levels in HeLa cells using small interfering RNAs results in inhibition of heat shock-induced nuclear accumulation of Hsp70s, indicating a role for this gene in regulation of Hsp70 nuclear import during heat shock stress. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for an ENU-induced mutation die prenatally or neonatally, and exhibit cyanoisis with a significant emphysematous phenotype at birth. The secretory apparatus in Clara cells is also affected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik A C 4: 144,528,997 D329A probably damaging Het
Abcc12 T A 8: 86,538,333 H661L probably damaging Het
Abcg4 A G 9: 44,275,375 Y491H probably damaging Het
Acsbg2 C G 17: 56,847,710 A481P probably damaging Het
Aknad1 T A 3: 108,781,185 C610S probably benign Het
Ang4 G T 14: 51,764,403 Y29* probably null Het
Aqp11 A T 7: 97,726,689 I251N possibly damaging Het
Arid1a G T 4: 133,691,176 T1032K unknown Het
Atg16l1 T C 1: 87,789,465 V538A probably benign Het
Bbs1 C T 19: 4,906,014 A44T probably damaging Het
Bpifa3 A C 2: 154,138,150 H234P probably damaging Het
Btbd9 A T 17: 30,530,214 V42E probably damaging Het
Carmil3 C G 14: 55,492,876 S15R probably damaging Het
Casp8ap2 A G 4: 32,640,185 D413G probably damaging Het
Cfap44 T A 16: 44,421,220 F651L probably benign Het
Clcn3 A T 8: 60,933,070 probably benign Het
Crip3 A G 17: 46,430,994 K136E probably damaging Het
Ctr9 G A 7: 111,043,947 A509T possibly damaging Het
D930020B18Rik T C 10: 121,689,821 S367P probably damaging Het
Dhrs11 A T 11: 84,823,150 L125H probably damaging Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Efcab7 A T 4: 99,901,637 probably benign Het
Eif2ak4 A C 2: 118,462,721 S1253R probably damaging Het
Emc1 A G 4: 139,371,009 D767G probably damaging Het
Fads1 G A 19: 10,186,897 probably benign Het
Fbxw26 T C 9: 109,718,011 T449A probably benign Het
Frrs1 T C 3: 116,896,788 F27L probably damaging Het
Fry T C 5: 150,451,098 S2358P possibly damaging Het
Gas6 A C 8: 13,470,344 L448R probably damaging Het
Ifngr1 C T 10: 19,609,449 R399* probably null Het
Itga2 G A 13: 114,870,496 S432L possibly damaging Het
Knl1 C T 2: 119,102,549 T2063I possibly damaging Het
Lyzl6 A G 11: 103,636,871 V9A probably benign Het
Macf1 A T 4: 123,488,314 probably benign Het
Myo6 T C 9: 80,283,534 V789A possibly damaging Het
Myo9b A T 8: 71,333,768 R693W probably damaging Het
Nasp A G 4: 116,605,771 probably benign Het
Nr1i3 T C 1: 171,217,331 F247L probably damaging Het
Plekhs1 T G 19: 56,478,516 S260A probably damaging Het
Rpl21-ps6 T C 17: 55,915,536 noncoding transcript Het
Rtcb A T 10: 85,949,451 probably benign Het
Sppl2a T A 2: 126,913,293 probably null Het
Suco A T 1: 161,845,585 probably null Het
Tnn T A 1: 160,104,928 T1075S probably benign Het
Traf3 T A 12: 111,243,478 C169* probably null Het
Ucp3 G T 7: 100,485,043 V288L probably benign Het
Ulk3 C A 9: 57,590,356 C4* probably null Het
Vmn1r73 A T 7: 11,757,070 T272S probably benign Het
Vmn2r115 G A 17: 23,346,278 E380K probably benign Het
Vmn2r3 T A 3: 64,275,366 N304I probably damaging Het
Xylt1 G T 7: 117,634,701 G485V probably damaging Het
Yars A G 4: 129,197,188 T130A probably benign Het
Zfp652 A T 11: 95,753,469 R205* probably null Het
Other mutations in Hikeshi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Hikeshi APN 7 89935781 missense probably damaging 0.99
IGL00502:Hikeshi APN 7 89923610 missense probably benign 0.34
IGL02296:Hikeshi APN 7 89935922 missense probably damaging 1.00
IGL02749:Hikeshi APN 7 89935889 missense possibly damaging 0.47
IGL03110:Hikeshi APN 7 89935826 missense probably damaging 1.00
R0591:Hikeshi UTSW 7 89920087 missense possibly damaging 0.74
R1119:Hikeshi UTSW 7 89935730 missense probably benign 0.04
R4646:Hikeshi UTSW 7 89923646 missense probably damaging 1.00
R6799:Hikeshi UTSW 7 89930345 intron probably benign
R7694:Hikeshi UTSW 7 89930346 nonsense probably null
R7698:Hikeshi UTSW 7 89923681 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACAGCAGCACTGGGACAAAATGCAA -3'
(R):5'- GGGGCGTACATATACAGAGGTGAAAGG -3'

Sequencing Primer
(F):5'- ctgagtcatctcgacagcc -3'
(R):5'- GTtcaaagaaatctgcctgttgc -3'
Posted On2014-05-07