Incidental Mutation 'R0023:Clcn3'
ID178051
Institutional Source Beutler Lab
Gene Symbol Clcn3
Ensembl Gene ENSMUSG00000004319
Gene Namechloride channel, voltage-sensitive 3
SynonymsClc3
MMRRC Submission 038318-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.489) question?
Stock #R0023 (G1)
Quality Score51
Status Validated
Chromosome8
Chromosomal Location60910389-60983300 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 60933070 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004430] [ENSMUST00000056508] [ENSMUST00000093490] [ENSMUST00000110301] [ENSMUST00000110302]
Predicted Effect probably benign
Transcript: ENSMUST00000004430
SMART Domains Protein: ENSMUSP00000004430
Gene: ENSMUSG00000004319

DomainStartEndE-ValueType
transmembrane domain 128 150 N/A INTRINSIC
Pfam:Voltage_CLC 220 623 1.4e-111 PFAM
CBS 667 717 2.46e-1 SMART
CBS 758 805 2.08e-8 SMART
low complexity region 847 861 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000056508
SMART Domains Protein: ENSMUSP00000058648
Gene: ENSMUSG00000004319

DomainStartEndE-ValueType
transmembrane domain 101 123 N/A INTRINSIC
Pfam:Voltage_CLC 193 596 1.4e-103 PFAM
CBS 640 690 2.46e-1 SMART
CBS 731 778 6.59e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093490
SMART Domains Protein: ENSMUSP00000091202
Gene: ENSMUSG00000004319

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
Pfam:Voltage_CLC 162 565 1.2e-103 PFAM
CBS 609 659 2.46e-1 SMART
CBS 700 747 6.59e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110301
SMART Domains Protein: ENSMUSP00000105930
Gene: ENSMUSG00000004319

DomainStartEndE-ValueType
transmembrane domain 128 150 N/A INTRINSIC
Pfam:Voltage_CLC 220 623 2.7e-103 PFAM
CBS 667 717 2.46e-1 SMART
CBS 758 805 6.59e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110302
SMART Domains Protein: ENSMUSP00000105931
Gene: ENSMUSG00000004319

DomainStartEndE-ValueType
transmembrane domain 101 123 N/A INTRINSIC
Pfam:Voltage_CLC 193 596 1.3e-103 PFAM
CBS 640 690 2.46e-1 SMART
CBS 731 778 2.08e-8 SMART
low complexity region 820 834 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132234
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147824
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the voltage-gated chloride channel (ClC) family. The encoded protein is present in all cell types and localized in plasma membranes and in intracellular vesicles. It is a multi-pass membrane protein which contains a ClC domain and two additional C-terminal CBS (cystathionine beta-synthase) domains. The ClC domain catalyzes the selective flow of Cl- ions across cell membranes, and the CBS domain may have a regulatory function. This protein plays a role in both acidification and transmitter loading of GABAergic synaptic vesicles, and in smooth muscle cell activation and neointima formation. This protein is required for lysophosphatidic acid (LPA)-activated Cl- current activity and fibroblast-to-myofibroblast differentiation. The protein activity is regulated by Ca(2+)/calmodulin-dependent protein kinase II (CaMKII) in glioma cells. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Nullizygous mutations cause degeneration of hippocampal neurons and retinal photoreceptors, reduced body weight, behavioral deficits, gliosis, kyphosis and premature death, and may alter male fertility, ileum morphology, liver physiology, seizure susceptibility, and behavioral response to drugs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik A C 4: 144,528,997 D329A probably damaging Het
Abcc12 T A 8: 86,538,333 H661L probably damaging Het
Abcg4 A G 9: 44,275,375 Y491H probably damaging Het
Acsbg2 C G 17: 56,847,710 A481P probably damaging Het
Aknad1 T A 3: 108,781,185 C610S probably benign Het
Ang4 G T 14: 51,764,403 Y29* probably null Het
Aqp11 A T 7: 97,726,689 I251N possibly damaging Het
Arid1a G T 4: 133,691,176 T1032K unknown Het
Atg16l1 T C 1: 87,789,465 V538A probably benign Het
Bbs1 C T 19: 4,906,014 A44T probably damaging Het
Bpifa3 A C 2: 154,138,150 H234P probably damaging Het
Btbd9 A T 17: 30,530,214 V42E probably damaging Het
Carmil3 C G 14: 55,492,876 S15R probably damaging Het
Casp8ap2 A G 4: 32,640,185 D413G probably damaging Het
Cfap44 T A 16: 44,421,220 F651L probably benign Het
Crip3 A G 17: 46,430,994 K136E probably damaging Het
Ctr9 G A 7: 111,043,947 A509T possibly damaging Het
D930020B18Rik T C 10: 121,689,821 S367P probably damaging Het
Dhrs11 A T 11: 84,823,150 L125H probably damaging Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Efcab7 A T 4: 99,901,637 probably benign Het
Eif2ak4 A C 2: 118,462,721 S1253R probably damaging Het
Emc1 A G 4: 139,371,009 D767G probably damaging Het
Fads1 G A 19: 10,186,897 probably benign Het
Fbxw26 T C 9: 109,718,011 T449A probably benign Het
Frrs1 T C 3: 116,896,788 F27L probably damaging Het
Fry T C 5: 150,451,098 S2358P possibly damaging Het
Gas6 A C 8: 13,470,344 L448R probably damaging Het
Hikeshi T C 7: 89,920,204 probably benign Het
Ifngr1 C T 10: 19,609,449 R399* probably null Het
Itga2 G A 13: 114,870,496 S432L possibly damaging Het
Knl1 C T 2: 119,102,549 T2063I possibly damaging Het
Lyzl6 A G 11: 103,636,871 V9A probably benign Het
Macf1 A T 4: 123,488,314 probably benign Het
Myo6 T C 9: 80,283,534 V789A possibly damaging Het
Myo9b A T 8: 71,333,768 R693W probably damaging Het
Nasp A G 4: 116,605,771 probably benign Het
Nr1i3 T C 1: 171,217,331 F247L probably damaging Het
Plekhs1 T G 19: 56,478,516 S260A probably damaging Het
Rpl21-ps6 T C 17: 55,915,536 noncoding transcript Het
Rtcb A T 10: 85,949,451 probably benign Het
Sppl2a T A 2: 126,913,293 probably null Het
Suco A T 1: 161,845,585 probably null Het
Tnn T A 1: 160,104,928 T1075S probably benign Het
Traf3 T A 12: 111,243,478 C169* probably null Het
Ucp3 G T 7: 100,485,043 V288L probably benign Het
Ulk3 C A 9: 57,590,356 C4* probably null Het
Vmn1r73 A T 7: 11,757,070 T272S probably benign Het
Vmn2r115 G A 17: 23,346,278 E380K probably benign Het
Vmn2r3 T A 3: 64,275,366 N304I probably damaging Het
Xylt1 G T 7: 117,634,701 G485V probably damaging Het
Yars A G 4: 129,197,188 T130A probably benign Het
Zfp652 A T 11: 95,753,469 R205* probably null Het
Other mutations in Clcn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00782:Clcn3 APN 8 60922792 missense probably damaging 0.99
IGL01088:Clcn3 APN 8 60937347 missense probably damaging 1.00
IGL01449:Clcn3 APN 8 60934598 missense probably damaging 0.97
IGL01792:Clcn3 APN 8 60929322 missense probably damaging 1.00
IGL01845:Clcn3 APN 8 60913095 missense probably benign 0.08
IGL01984:Clcn3 APN 8 60929580 missense probably damaging 1.00
IGL02041:Clcn3 APN 8 60923153 missense probably damaging 0.99
IGL02199:Clcn3 APN 8 60933092 nonsense probably null
IGL02199:Clcn3 APN 8 60927274 missense possibly damaging 0.82
IGL02456:Clcn3 APN 8 60941357 missense probably damaging 1.00
IGL03353:Clcn3 APN 8 60922988 missense probably benign 0.37
Precipice UTSW 8 60941399 missense probably benign 0.16
R0003:Clcn3 UTSW 8 60927296 nonsense probably null
R0023:Clcn3 UTSW 8 60933070 splice site probably benign
R0349:Clcn3 UTSW 8 60941348 missense possibly damaging 0.91
R0437:Clcn3 UTSW 8 60934537 missense possibly damaging 0.69
R0784:Clcn3 UTSW 8 60929203 missense probably benign 0.25
R0840:Clcn3 UTSW 8 60929154 missense probably benign 0.22
R1167:Clcn3 UTSW 8 60922788 critical splice donor site probably null
R2035:Clcn3 UTSW 8 60934598 missense probably damaging 0.97
R2193:Clcn3 UTSW 8 60929187 missense possibly damaging 0.56
R3697:Clcn3 UTSW 8 60913123 missense probably benign 0.02
R3736:Clcn3 UTSW 8 60983652 unclassified probably benign
R4676:Clcn3 UTSW 8 60930651 intron probably benign
R4807:Clcn3 UTSW 8 60934530 missense probably damaging 1.00
R5112:Clcn3 UTSW 8 60954552 missense probably benign 0.07
R5200:Clcn3 UTSW 8 60923005 missense probably damaging 0.99
R5652:Clcn3 UTSW 8 60919353 missense possibly damaging 0.81
R5712:Clcn3 UTSW 8 60937298 critical splice donor site probably null
R5731:Clcn3 UTSW 8 60922889 missense possibly damaging 0.46
R5814:Clcn3 UTSW 8 60934573 missense probably damaging 1.00
R6134:Clcn3 UTSW 8 60934573 missense probably damaging 1.00
R6370:Clcn3 UTSW 8 60923024 missense probably damaging 1.00
R6371:Clcn3 UTSW 8 60937335 missense probably benign 0.06
R6394:Clcn3 UTSW 8 60941291 missense probably damaging 0.99
R6466:Clcn3 UTSW 8 60929561 missense probably damaging 1.00
R6588:Clcn3 UTSW 8 60914827 missense probably benign 0.03
R6750:Clcn3 UTSW 8 60914775 missense possibly damaging 0.93
R7522:Clcn3 UTSW 8 60941412 missense probably benign
R7556:Clcn3 UTSW 8 60929487 missense probably damaging 0.99
R7557:Clcn3 UTSW 8 60937368 missense probably damaging 0.99
R7685:Clcn3 UTSW 8 60933085 missense possibly damaging 0.54
R7887:Clcn3 UTSW 8 60941399 missense probably benign 0.16
R8219:Clcn3 UTSW 8 60922966 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCACTCAACTCCAGAAAGGTGAACG -3'
(R):5'- CACACAATTCCAGTGTGGTAAGAAAGC -3'

Sequencing Primer
(F):5'- CTCCAGAAAGGTGAACGTTACG -3'
(R):5'- GCGAAGTTAAGTTCTCAAGTTTCC -3'
Posted On2014-05-07