Incidental Mutation 'R0023:Ifngr1'
ID178055
Institutional Source Beutler Lab
Gene Symbol Ifngr1
Ensembl Gene ENSMUSG00000020009
Gene Nameinterferon gamma receptor 1
SynonymsCD119, Ifgr, IFN-gamma R, Nktar, Ifngr, IFN-gammaR
MMRRC Submission 038318-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0023 (G1)
Quality Score37
Status Validated
Chromosome10
Chromosomal Location19591949-19610229 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 19609449 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 399 (R399*)
Ref Sequence ENSEMBL: ENSMUSP00000020188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020188] [ENSMUST00000164591]
Predicted Effect probably null
Transcript: ENSMUST00000020188
AA Change: R399*
SMART Domains Protein: ENSMUSP00000020188
Gene: ENSMUSG00000020009
AA Change: R399*

DomainStartEndE-ValueType
Pfam:Tissue_fac 9 119 2.2e-27 PFAM
Pfam:Interfer-bind 131 245 8.5e-9 PFAM
Pfam:IFNGR1 168 331 1.6e-53 PFAM
low complexity region 401 416 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164591
SMART Domains Protein: ENSMUSP00000129309
Gene: ENSMUSG00000020009

DomainStartEndE-ValueType
Pfam:Tissue_fac 9 74 2.3e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168074
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene (IFNGR1) encodes the ligand-binding chain (alpha) of the gamma interferon receptor. Human interferon-gamma receptor is a heterodimer of IFNGR1 and IFNGR2. A genetic variation in IFNGR1 is associated with susceptibility to Helicobacter pylori infection. In addition, defects in IFNGR1 are a cause of mendelian susceptibility to mycobacterial disease, also known as familial disseminated atypical mycobacterial infection. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutant allele exhibit increased susceptibility to viral infection and experimental autoimmune uveoretinitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik A C 4: 144,528,997 D329A probably damaging Het
Abcc12 T A 8: 86,538,333 H661L probably damaging Het
Abcg4 A G 9: 44,275,375 Y491H probably damaging Het
Acsbg2 C G 17: 56,847,710 A481P probably damaging Het
Aknad1 T A 3: 108,781,185 C610S probably benign Het
Ang4 G T 14: 51,764,403 Y29* probably null Het
Aqp11 A T 7: 97,726,689 I251N possibly damaging Het
Arid1a G T 4: 133,691,176 T1032K unknown Het
Atg16l1 T C 1: 87,789,465 V538A probably benign Het
Bbs1 C T 19: 4,906,014 A44T probably damaging Het
Bpifa3 A C 2: 154,138,150 H234P probably damaging Het
Btbd9 A T 17: 30,530,214 V42E probably damaging Het
Carmil3 C G 14: 55,492,876 S15R probably damaging Het
Casp8ap2 A G 4: 32,640,185 D413G probably damaging Het
Cfap44 T A 16: 44,421,220 F651L probably benign Het
Clcn3 A T 8: 60,933,070 probably benign Het
Crip3 A G 17: 46,430,994 K136E probably damaging Het
Ctr9 G A 7: 111,043,947 A509T possibly damaging Het
D930020B18Rik T C 10: 121,689,821 S367P probably damaging Het
Dhrs11 A T 11: 84,823,150 L125H probably damaging Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Efcab7 A T 4: 99,901,637 probably benign Het
Eif2ak4 A C 2: 118,462,721 S1253R probably damaging Het
Emc1 A G 4: 139,371,009 D767G probably damaging Het
Fads1 G A 19: 10,186,897 probably benign Het
Fbxw26 T C 9: 109,718,011 T449A probably benign Het
Frrs1 T C 3: 116,896,788 F27L probably damaging Het
Fry T C 5: 150,451,098 S2358P possibly damaging Het
Gas6 A C 8: 13,470,344 L448R probably damaging Het
Hikeshi T C 7: 89,920,204 probably benign Het
Itga2 G A 13: 114,870,496 S432L possibly damaging Het
Knl1 C T 2: 119,102,549 T2063I possibly damaging Het
Lyzl6 A G 11: 103,636,871 V9A probably benign Het
Macf1 A T 4: 123,488,314 probably benign Het
Myo6 T C 9: 80,283,534 V789A possibly damaging Het
Myo9b A T 8: 71,333,768 R693W probably damaging Het
Nasp A G 4: 116,605,771 probably benign Het
Nr1i3 T C 1: 171,217,331 F247L probably damaging Het
Plekhs1 T G 19: 56,478,516 S260A probably damaging Het
Rpl21-ps6 T C 17: 55,915,536 noncoding transcript Het
Rtcb A T 10: 85,949,451 probably benign Het
Sppl2a T A 2: 126,913,293 probably null Het
Suco A T 1: 161,845,585 probably null Het
Tnn T A 1: 160,104,928 T1075S probably benign Het
Traf3 T A 12: 111,243,478 C169* probably null Het
Ucp3 G T 7: 100,485,043 V288L probably benign Het
Ulk3 C A 9: 57,590,356 C4* probably null Het
Vmn1r73 A T 7: 11,757,070 T272S probably benign Het
Vmn2r115 G A 17: 23,346,278 E380K probably benign Het
Vmn2r3 T A 3: 64,275,366 N304I probably damaging Het
Xylt1 G T 7: 117,634,701 G485V probably damaging Het
Yars A G 4: 129,197,188 T130A probably benign Het
Zfp652 A T 11: 95,753,469 R205* probably null Het
Other mutations in Ifngr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Ifngr1 APN 10 19609198 missense probably damaging 0.99
IGL01125:Ifngr1 APN 10 19597413 splice site probably benign
IGL01366:Ifngr1 APN 10 19609600 missense probably damaging 1.00
IGL01951:Ifngr1 APN 10 19609454 missense possibly damaging 0.94
IGL02037:Ifngr1 APN 10 19607259 missense probably benign 0.26
Marigold UTSW 10 19601485 critical splice donor site probably null
BB007:Ifngr1 UTSW 10 19609183 missense probably damaging 1.00
BB017:Ifngr1 UTSW 10 19609183 missense probably damaging 1.00
R0325:Ifngr1 UTSW 10 19597432 missense probably damaging 1.00
R0590:Ifngr1 UTSW 10 19603942 splice site probably benign
R1305:Ifngr1 UTSW 10 19606253 missense possibly damaging 0.91
R1496:Ifngr1 UTSW 10 19601445 missense probably benign 0.04
R1597:Ifngr1 UTSW 10 19609342 missense probably damaging 0.99
R2019:Ifngr1 UTSW 10 19592113 missense probably damaging 0.99
R2302:Ifngr1 UTSW 10 19609645 missense probably damaging 1.00
R2484:Ifngr1 UTSW 10 19601415 missense probably damaging 1.00
R4089:Ifngr1 UTSW 10 19601485 critical splice donor site probably null
R4464:Ifngr1 UTSW 10 19597517 missense possibly damaging 0.75
R4863:Ifngr1 UTSW 10 19609416 missense probably damaging 1.00
R6045:Ifngr1 UTSW 10 19609161 missense possibly damaging 0.61
R6047:Ifngr1 UTSW 10 19606313 missense probably damaging 1.00
R6089:Ifngr1 UTSW 10 19606300 missense probably benign 0.01
R6750:Ifngr1 UTSW 10 19609351 missense probably benign 0.06
R6950:Ifngr1 UTSW 10 19607293 missense probably damaging 0.99
R7162:Ifngr1 UTSW 10 19609353 missense probably benign
R7930:Ifngr1 UTSW 10 19609183 missense probably damaging 1.00
R8178:Ifngr1 UTSW 10 19609493 missense probably benign 0.03
R8436:Ifngr1 UTSW 10 19603805 missense probably damaging 1.00
T0975:Ifngr1 UTSW 10 19609473 missense probably damaging 0.98
X0005:Ifngr1 UTSW 10 19609473 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTATTCACTTGTCACACCGCACC -3'
(R):5'- TCAGTTTCTTTACCACCAGCAGGC -3'

Sequencing Primer
(F):5'- TGATCTGTGAAGAGCCCCTG -3'
(R):5'- CTGTGAGTCTATACCCCATGAGAG -3'
Posted On2014-05-07