Incidental Mutation 'R0023:Fads1'
ID178067
Institutional Source Beutler Lab
Gene Symbol Fads1
Ensembl Gene ENSMUSG00000010663
Gene Namefatty acid desaturase 1
SynonymsA930006B21Rik, 0710001O03Rik
MMRRC Submission 038318-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0023 (G1)
Quality Score54
Status Validated
Chromosome19
Chromosomal Location10182888-10196870 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 10186897 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000010807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010807]
Predicted Effect probably benign
Transcript: ENSMUST00000010807
SMART Domains Protein: ENSMUSP00000010807
Gene: ENSMUSG00000010663

DomainStartEndE-ValueType
Cyt-b5 22 97 1.32e-19 SMART
transmembrane domain 134 156 N/A INTRINSIC
Pfam:FA_desaturase 158 421 7.4e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184912
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fatty acid desaturase (FADS) gene family. Desaturase enzymes regulate unsaturation of fatty acids through the introduction of double bonds between defined carbons of the fatty acyl chain. FADS family members are considered fusion products composed of an N-terminal cytochrome b5-like domain and a C-terminal multiple membrane-spanning desaturase portion, both of which are characterized by conserved histidine motifs. This gene is clustered with family members FADS1 and FADS2 at 11q12-q13.1; this cluster is thought to have arisen evolutionarily from gene duplication based on its similar exon/intron organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit arachidonic acid deficiency with premature lethality and altered prostaglandin levels. Heterozygous mice exhibit an intermediate phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik A C 4: 144,528,997 D329A probably damaging Het
Abcc12 T A 8: 86,538,333 H661L probably damaging Het
Abcg4 A G 9: 44,275,375 Y491H probably damaging Het
Acsbg2 C G 17: 56,847,710 A481P probably damaging Het
Aknad1 T A 3: 108,781,185 C610S probably benign Het
Ang4 G T 14: 51,764,403 Y29* probably null Het
Aqp11 A T 7: 97,726,689 I251N possibly damaging Het
Arid1a G T 4: 133,691,176 T1032K unknown Het
Atg16l1 T C 1: 87,789,465 V538A probably benign Het
Bbs1 C T 19: 4,906,014 A44T probably damaging Het
Bpifa3 A C 2: 154,138,150 H234P probably damaging Het
Btbd9 A T 17: 30,530,214 V42E probably damaging Het
Carmil3 C G 14: 55,492,876 S15R probably damaging Het
Casp8ap2 A G 4: 32,640,185 D413G probably damaging Het
Cfap44 T A 16: 44,421,220 F651L probably benign Het
Clcn3 A T 8: 60,933,070 probably benign Het
Crip3 A G 17: 46,430,994 K136E probably damaging Het
Ctr9 G A 7: 111,043,947 A509T possibly damaging Het
D930020B18Rik T C 10: 121,689,821 S367P probably damaging Het
Dhrs11 A T 11: 84,823,150 L125H probably damaging Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Efcab7 A T 4: 99,901,637 probably benign Het
Eif2ak4 A C 2: 118,462,721 S1253R probably damaging Het
Emc1 A G 4: 139,371,009 D767G probably damaging Het
Fbxw26 T C 9: 109,718,011 T449A probably benign Het
Frrs1 T C 3: 116,896,788 F27L probably damaging Het
Fry T C 5: 150,451,098 S2358P possibly damaging Het
Gas6 A C 8: 13,470,344 L448R probably damaging Het
Hikeshi T C 7: 89,920,204 probably benign Het
Ifngr1 C T 10: 19,609,449 R399* probably null Het
Itga2 G A 13: 114,870,496 S432L possibly damaging Het
Knl1 C T 2: 119,102,549 T2063I possibly damaging Het
Lyzl6 A G 11: 103,636,871 V9A probably benign Het
Macf1 A T 4: 123,488,314 probably benign Het
Myo6 T C 9: 80,283,534 V789A possibly damaging Het
Myo9b A T 8: 71,333,768 R693W probably damaging Het
Nasp A G 4: 116,605,771 probably benign Het
Nr1i3 T C 1: 171,217,331 F247L probably damaging Het
Plekhs1 T G 19: 56,478,516 S260A probably damaging Het
Rpl21-ps6 T C 17: 55,915,536 noncoding transcript Het
Rtcb A T 10: 85,949,451 probably benign Het
Sppl2a T A 2: 126,913,293 probably null Het
Suco A T 1: 161,845,585 probably null Het
Tnn T A 1: 160,104,928 T1075S probably benign Het
Traf3 T A 12: 111,243,478 C169* probably null Het
Ucp3 G T 7: 100,485,043 V288L probably benign Het
Ulk3 C A 9: 57,590,356 C4* probably null Het
Vmn1r73 A T 7: 11,757,070 T272S probably benign Het
Vmn2r115 G A 17: 23,346,278 E380K probably benign Het
Vmn2r3 T A 3: 64,275,366 N304I probably damaging Het
Xylt1 G T 7: 117,634,701 G485V probably damaging Het
Yars A G 4: 129,197,188 T130A probably benign Het
Zfp652 A T 11: 95,753,469 R205* probably null Het
Other mutations in Fads1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01512:Fads1 APN 19 10183142 missense probably benign 0.02
IGL01536:Fads1 APN 19 10194030 missense probably benign 0.36
IGL02642:Fads1 APN 19 10186421 missense probably damaging 1.00
teewinot UTSW 19 10185727 nonsense probably null
R0023:Fads1 UTSW 19 10186897 splice site probably benign
R0367:Fads1 UTSW 19 10183065 missense probably benign 0.12
R0464:Fads1 UTSW 19 10183065 missense probably benign 0.12
R0465:Fads1 UTSW 19 10183065 missense probably benign 0.12
R0534:Fads1 UTSW 19 10183065 missense probably benign 0.12
R0848:Fads1 UTSW 19 10183065 missense probably benign 0.12
R1456:Fads1 UTSW 19 10185752 missense probably benign 0.06
R1697:Fads1 UTSW 19 10194100 splice site probably benign
R5576:Fads1 UTSW 19 10185874 missense probably benign 0.00
R5640:Fads1 UTSW 19 10186403 missense probably damaging 1.00
R6243:Fads1 UTSW 19 10185727 nonsense probably null
R6379:Fads1 UTSW 19 10183187 missense probably damaging 1.00
R7593:Fads1 UTSW 19 10184997 missense probably damaging 1.00
R7845:Fads1 UTSW 19 10194041 missense probably damaging 1.00
Z1176:Fads1 UTSW 19 10193704 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGCACCTCGACATGGAATCAC -3'
(R):5'- GGCTTGCACAGACTCCCCTATAAC -3'

Sequencing Primer
(F):5'- ggtgctaagaactgaagcagg -3'
(R):5'- CTGAATCCTCTACAGAGTGGGAC -3'
Posted On2014-05-07