Incidental Mutation 'R0423:Dhcr24'
ID 186129
Institutional Source Beutler Lab
Gene Symbol Dhcr24
Ensembl Gene ENSMUSG00000034926
Gene Name 24-dehydrocholesterol reductase
Synonyms 5830417J06Rik, seladin-1, 2310076D10Rik, 3-beta-hydroxysterol delta-24 reductase
MMRRC Submission 038625-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.872) question?
Stock # R0423 (G1)
Quality Score 37
Status Validated
Chromosome 4
Chromosomal Location 106418279-106446310 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) G to A at 106443733 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047973] [ENSMUST00000067387] [ENSMUST00000106788] [ENSMUST00000126324] [ENSMUST00000189032]
AlphaFold Q8VCH6
Predicted Effect probably benign
Transcript: ENSMUST00000047973
SMART Domains Protein: ENSMUSP00000038063
Gene: ENSMUSG00000034926

DomainStartEndE-ValueType
Pfam:FAD_binding_4 71 203 2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067387
SMART Domains Protein: ENSMUSP00000066732
Gene: ENSMUSG00000054362

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 63 83 1.3e-2 PFAM
Pfam:SHIPPO-rpt 119 152 3.5e-4 PFAM
low complexity region 157 173 N/A INTRINSIC
Pfam:SHIPPO-rpt 205 240 4.3e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106788
SMART Domains Protein: ENSMUSP00000102400
Gene: ENSMUSG00000054362

DomainStartEndE-ValueType
internal_repeat_1 62 146 2.56e-5 PROSPERO
low complexity region 157 173 N/A INTRINSIC
internal_repeat_1 204 279 2.56e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000126324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146976
Predicted Effect probably benign
Transcript: ENSMUST00000189032
SMART Domains Protein: ENSMUSP00000139868
Gene: ENSMUSG00000054362

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 63 83 1.3e-2 PFAM
Pfam:SHIPPO-rpt 119 152 3.5e-4 PFAM
low complexity region 157 173 N/A INTRINSIC
Pfam:SHIPPO-rpt 205 240 4.3e-3 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.9%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a flavin adenine dinucleotide (FAD)-dependent oxidoreductase which catalyzes the reduction of the delta-24 double bond of sterol intermediates during cholesterol biosynthesis. The protein contains a leader sequence that directs it to the endoplasmic reticulum membrane. Missense mutations in this gene have been associated with desmosterolosis. Also, reduced expression of the gene occurs in the temporal cortex of Alzheimer disease patients and overexpression has been observed in adrenal gland cancer cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: In spite of having almost no plasma or tissue cholesterol, homozygous mutant mice are largely viable and display a mild growth phenotype. Inactivation did impair prenatal viability as well as infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A T 7: 29,261,825 (GRCm39) noncoding transcript Het
A630001G21Rik A G 1: 85,654,187 (GRCm39) I50T probably benign Het
Abhd12 T C 2: 150,680,312 (GRCm39) T264A possibly damaging Het
Acsm3 T C 7: 119,376,382 (GRCm39) Y370H probably damaging Het
Ank2 G T 3: 126,723,509 (GRCm39) Y3789* probably null Het
Anxa4 C T 6: 86,737,719 (GRCm39) A1T probably damaging Het
Apba1 T A 19: 23,922,362 (GRCm39) V810D probably damaging Het
Bank1 A G 3: 135,989,778 (GRCm39) I104T possibly damaging Het
Birc6 T C 17: 75,003,292 (GRCm39) Y4721H probably damaging Het
Bmpr2 A G 1: 59,907,669 (GRCm39) T921A probably benign Het
Ccdc102a A C 8: 95,632,554 (GRCm39) probably benign Het
Ccdc141 C A 2: 76,869,794 (GRCm39) D904Y probably damaging Het
Ccdc96 A G 5: 36,642,591 (GRCm39) K199R probably benign Het
Cdh10 G A 15: 18,986,965 (GRCm39) V399I probably benign Het
Cenpk A G 13: 104,370,733 (GRCm39) T85A probably benign Het
Col6a2 A C 10: 76,450,751 (GRCm39) V60G possibly damaging Het
Cops7b A G 1: 86,526,753 (GRCm39) D119G probably benign Het
Cstf2t A G 19: 31,061,676 (GRCm39) E404G possibly damaging Het
Ctnna2 A T 6: 77,630,052 (GRCm39) V134E probably damaging Het
Cwh43 A C 5: 73,574,085 (GRCm39) M250L probably benign Het
Daam2 T A 17: 49,776,449 (GRCm39) K813* probably null Het
Dnah8 G T 17: 30,920,955 (GRCm39) R1182L probably benign Het
Doc2a C T 7: 126,447,830 (GRCm39) P25S probably damaging Het
Dst A G 1: 34,317,116 (GRCm39) S6823G possibly damaging Het
Espl1 T A 15: 102,212,421 (GRCm39) L509* probably null Het
Fbxw19 C T 9: 109,315,134 (GRCm39) V143I probably benign Het
Fbxw5 A G 2: 25,394,538 (GRCm39) T171A possibly damaging Het
Gfra2 C T 14: 71,133,521 (GRCm39) T117M probably damaging Het
Gm454 T A 5: 138,202,403 (GRCm39) noncoding transcript Het
Ilrun A C 17: 28,005,207 (GRCm39) Y117D probably damaging Het
Kcnq4 A G 4: 120,574,705 (GRCm39) S120P probably damaging Het
Krt84 A T 15: 101,437,155 (GRCm39) L336Q probably damaging Het
Lilra6 T A 7: 3,917,774 (GRCm39) probably benign Het
Mbnl2 G A 14: 120,562,736 (GRCm39) R29H probably damaging Het
Mcm3ap G A 10: 76,338,539 (GRCm39) G1389D probably benign Het
Mettl13 A T 1: 162,371,954 (GRCm39) I305N probably damaging Het
Muc6 A G 7: 141,238,548 (GRCm39) S30P probably benign Het
Myh7 T A 14: 55,216,646 (GRCm39) Q1237L probably benign Het
Myo9a T G 9: 59,802,619 (GRCm39) D2035E probably damaging Het
Nat10 A G 2: 103,578,572 (GRCm39) S211P probably damaging Het
Ntm T C 9: 29,090,395 (GRCm39) Y108C probably damaging Het
Or14c39 T C 7: 86,344,434 (GRCm39) Y257H possibly damaging Het
Or7g25 A T 9: 19,160,248 (GRCm39) L149* probably null Het
Pcdhb16 A G 18: 37,613,422 (GRCm39) D794G probably benign Het
Phlpp1 A G 1: 106,267,345 (GRCm39) T753A probably benign Het
Pierce1 T C 2: 28,356,036 (GRCm39) probably benign Het
Pnldc1 T C 17: 13,108,963 (GRCm39) Q511R possibly damaging Het
Ppip5k2 A G 1: 97,689,152 (GRCm39) S38P possibly damaging Het
Pygb A G 2: 150,665,904 (GRCm39) K593E probably benign Het
Rangap1 A T 15: 81,589,664 (GRCm39) F564I probably damaging Het
Rictor A T 15: 6,803,381 (GRCm39) I498F possibly damaging Het
Rnase12 A T 14: 51,294,613 (GRCm39) V22D probably benign Het
Rpl7l1 T A 17: 47,091,324 (GRCm39) M93L probably benign Het
Smg1 T C 7: 117,776,103 (GRCm39) R1396G possibly damaging Het
Snx19 C A 9: 30,347,133 (GRCm39) T692N probably damaging Het
Spag6 A G 2: 18,715,404 (GRCm39) D61G probably benign Het
Spen T A 4: 141,206,647 (GRCm39) N660I unknown Het
Sptan1 T G 2: 29,918,684 (GRCm39) C2246G probably null Het
Svopl A G 6: 38,013,642 (GRCm39) probably benign Het
Taf2 A T 15: 54,928,078 (GRCm39) N108K probably benign Het
Thbs4 T C 13: 92,893,079 (GRCm39) D703G probably damaging Het
Tle6 G T 10: 81,434,457 (GRCm39) N47K possibly damaging Het
Usp48 G T 4: 137,343,722 (GRCm39) V452L probably benign Het
Ust A T 10: 8,173,912 (GRCm39) S198T probably damaging Het
Wnk2 T A 13: 49,248,894 (GRCm39) M386L possibly damaging Het
Ywhaq T C 12: 21,441,382 (GRCm39) probably benign Het
Zfp11 C T 5: 129,735,302 (GRCm39) G53E possibly damaging Het
Zfp316 A G 5: 143,238,993 (GRCm39) S1009P probably damaging Het
Zfp963 A G 8: 70,197,156 (GRCm39) Y29H probably damaging Het
Zmym4 A G 4: 126,776,112 (GRCm39) probably benign Het
Zranb3 A G 1: 128,019,607 (GRCm39) I45T probably damaging Het
Other mutations in Dhcr24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Dhcr24 APN 4 106,429,475 (GRCm39) missense possibly damaging 0.50
IGL01548:Dhcr24 APN 4 106,431,068 (GRCm39) nonsense probably null
IGL02110:Dhcr24 APN 4 106,430,998 (GRCm39) missense probably damaging 1.00
IGL02256:Dhcr24 APN 4 106,429,517 (GRCm39) missense probably damaging 0.98
IGL02748:Dhcr24 APN 4 106,421,589 (GRCm39) splice site probably benign
IGL02926:Dhcr24 APN 4 106,443,552 (GRCm39) missense probably damaging 0.98
ANU22:Dhcr24 UTSW 4 106,429,475 (GRCm39) missense possibly damaging 0.50
R1632:Dhcr24 UTSW 4 106,443,148 (GRCm39) missense probably benign
R1771:Dhcr24 UTSW 4 106,435,450 (GRCm39) missense probably benign 0.00
R2138:Dhcr24 UTSW 4 106,429,499 (GRCm39) nonsense probably null
R2139:Dhcr24 UTSW 4 106,429,499 (GRCm39) nonsense probably null
R2420:Dhcr24 UTSW 4 106,418,291 (GRCm39) start gained probably benign
R2422:Dhcr24 UTSW 4 106,418,291 (GRCm39) start gained probably benign
R2570:Dhcr24 UTSW 4 106,443,029 (GRCm39) missense probably benign 0.00
R3176:Dhcr24 UTSW 4 106,418,436 (GRCm39) missense probably benign 0.16
R3276:Dhcr24 UTSW 4 106,418,436 (GRCm39) missense probably benign 0.16
R3842:Dhcr24 UTSW 4 106,443,002 (GRCm39) missense probably damaging 1.00
R3852:Dhcr24 UTSW 4 106,431,070 (GRCm39) missense probably benign 0.02
R4037:Dhcr24 UTSW 4 106,431,075 (GRCm39) missense probably benign 0.01
R4038:Dhcr24 UTSW 4 106,431,075 (GRCm39) missense probably benign 0.01
R4039:Dhcr24 UTSW 4 106,431,075 (GRCm39) missense probably benign 0.01
R5831:Dhcr24 UTSW 4 106,421,611 (GRCm39) missense probably benign 0.03
R7285:Dhcr24 UTSW 4 106,428,716 (GRCm39) critical splice donor site probably null
R7821:Dhcr24 UTSW 4 106,428,633 (GRCm39) missense possibly damaging 0.61
R8012:Dhcr24 UTSW 4 106,443,853 (GRCm39) missense probably damaging 1.00
R8879:Dhcr24 UTSW 4 106,431,006 (GRCm39) missense probably benign 0.05
X0057:Dhcr24 UTSW 4 106,443,542 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACAGACCAAGCTGTTTCTCTGACC -3'
(R):5'- GCCTTGCAGATCTTGTCGTACACC -3'

Sequencing Primer
(F):5'- AGGTCTACCCCATCTGGC -3'
(R):5'- TTGTCGTACACCTCAGGGAAG -3'
Posted On 2014-05-07