Incidental Mutation 'R0391:Klk1b26'
ID 186148
Institutional Source Beutler Lab
Gene Symbol Klk1b26
Ensembl Gene ENSMUSG00000053719
Gene Name kallikrein 1-related petidase b26
Synonyms Egfbp2, Klk26, EGF-BP type B, mGK-26, PRECE-2
MMRRC Submission 038597-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R0391 (G1)
Quality Score 45
Status Validated
Chromosome 7
Chromosomal Location 43662102-43666393 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 43662151 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 3 (F3Y)
Ref Sequence ENSEMBL: ENSMUSP00000047488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048945]
AlphaFold P36369
Predicted Effect probably damaging
Transcript: ENSMUST00000048945
AA Change: F3Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000047488
Gene: ENSMUSG00000053719
AA Change: F3Y

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 253 2.29e-92 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206650
Meta Mutation Damage Score 0.1394 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency 97% (97/100)
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of the peptidase S1 family of serine proteases. The kallikrein genes are present in a large gene cluster on chromosome 7. The encoded preproprotein is proteolytically processed to generate a mature protein product. Expression of this gene in the submandibular gland is sexually dimorphic likely due to both transcriptional and post-transcriptional regulation. This gene is thought to be distinct from the Egfbp2 gene (Gene ID: 13647), with which it shares 98% identity (PMIDs: 1959648, 9685728), however, it is not clear if both genes are present in all strains of mice. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik T A 4: 122,594,970 (GRCm39) probably benign Het
Abcc2 G A 19: 43,810,044 (GRCm39) probably benign Het
Abcc8 C G 7: 45,771,597 (GRCm39) G838A probably damaging Het
Akr1c21 G A 13: 4,631,199 (GRCm39) A245T probably damaging Het
Anapc15-ps T C 10: 95,509,139 (GRCm39) E47G probably damaging Het
Apoa1 A G 9: 46,141,140 (GRCm39) T79A probably benign Het
Atp6v1b1 A G 6: 83,733,903 (GRCm39) H378R possibly damaging Het
C4b A G 17: 34,954,588 (GRCm39) probably benign Het
Catsperd A T 17: 56,969,821 (GRCm39) E638D probably benign Het
Cckar C T 5: 53,863,595 (GRCm39) probably null Het
Cfap100 C T 6: 90,382,321 (GRCm39) probably benign Het
Chd1 G T 17: 15,970,156 (GRCm39) G970C probably damaging Het
Col14a1 A G 15: 55,309,655 (GRCm39) probably benign Het
Col17a1 C T 19: 47,652,263 (GRCm39) V698M probably damaging Het
Cpeb1 T C 7: 81,011,473 (GRCm39) D156G possibly damaging Het
Cryl1 A G 14: 57,541,232 (GRCm39) Y151H possibly damaging Het
Csmd3 C A 15: 47,520,969 (GRCm39) V1881L probably damaging Het
Ctnnal1 C T 4: 56,847,921 (GRCm39) A73T probably damaging Het
Cyp2c37 T C 19: 39,982,950 (GRCm39) S180P probably damaging Het
Cyp2c54 T C 19: 40,060,613 (GRCm39) T123A possibly damaging Het
Dennd6b T C 15: 89,071,417 (GRCm39) D304G probably damaging Het
Dnmt3l T C 10: 77,887,750 (GRCm39) probably benign Het
Eci1 G A 17: 24,652,234 (GRCm39) probably null Het
Efhc1 A G 1: 21,030,412 (GRCm39) Y115C probably damaging Het
Ern1 T A 11: 106,298,004 (GRCm39) K706* probably null Het
Ghrl T C 6: 113,696,299 (GRCm39) E31G probably damaging Het
Gpr108 A C 17: 57,550,101 (GRCm39) V179G probably benign Het
Henmt1 A G 3: 108,865,851 (GRCm39) probably benign Het
Ift172 A G 5: 31,444,011 (GRCm39) V69A probably damaging Het
Il17ra T C 6: 120,453,940 (GRCm39) probably benign Het
Il17rb T C 14: 29,726,304 (GRCm39) N95D probably benign Het
Il17rb G T 14: 29,728,112 (GRCm39) probably null Het
Iqub G A 6: 24,446,154 (GRCm39) L757F probably benign Het
Itpr1 T C 6: 108,355,128 (GRCm39) V473A probably benign Het
Itpr2 T G 6: 146,131,271 (GRCm39) N1978H probably damaging Het
Lars1 A G 18: 42,384,428 (GRCm39) V50A probably benign Het
Lax1 G T 1: 133,607,804 (GRCm39) H312Q probably benign Het
Lctl T C 9: 64,029,596 (GRCm39) probably benign Het
Lrp2 T A 2: 69,287,202 (GRCm39) D3745V probably damaging Het
Lrp2 G A 2: 69,290,681 (GRCm39) probably benign Het
Lvrn A T 18: 46,983,533 (GRCm39) H92L probably benign Het
Marchf1 A G 8: 66,871,625 (GRCm39) T385A probably damaging Het
Marf1 C T 16: 13,960,398 (GRCm39) A549T probably damaging Het
Mbd5 T C 2: 49,162,428 (GRCm39) V970A possibly damaging Het
Mccc1 A G 3: 36,017,719 (GRCm39) probably benign Het
Mpp4 A T 1: 59,182,988 (GRCm39) probably benign Het
Mrnip G A 11: 50,090,747 (GRCm39) A304T probably damaging Het
Muc5b T C 7: 141,418,819 (GRCm39) S3922P possibly damaging Het
Myh3 T A 11: 66,987,333 (GRCm39) probably benign Het
Nbea A T 3: 55,944,698 (GRCm39) H555Q probably damaging Het
Niban3 T A 8: 72,055,143 (GRCm39) probably benign Het
Nlrp9c A T 7: 26,070,901 (GRCm39) probably benign Het
Nmur1 A T 1: 86,315,400 (GRCm39) V178E probably damaging Het
Nod2 T G 8: 89,390,406 (GRCm39) S238A probably benign Het
Ogfod1 A T 8: 94,789,651 (GRCm39) T451S probably damaging Het
Or1e17 T C 11: 73,831,935 (GRCm39) F288L probably damaging Het
Or2d36 T A 7: 106,747,394 (GRCm39) Y290* probably null Het
Or2z8 C T 8: 72,812,244 (GRCm39) T240M probably damaging Het
Or8b8 G A 9: 37,809,138 (GRCm39) G146D probably benign Het
Pcdh20 T C 14: 88,706,104 (GRCm39) I399V probably benign Het
Pdlim1 G T 19: 40,232,017 (GRCm39) H120Q probably damaging Het
Plg T C 17: 12,637,968 (GRCm39) V798A probably damaging Het
Polr2c A G 8: 95,584,403 (GRCm39) I39V possibly damaging Het
Ppfia2 C A 10: 106,666,575 (GRCm39) probably benign Het
Ppp1r3a A T 6: 14,719,696 (GRCm39) I406N probably benign Het
Psg28 A T 7: 18,160,098 (GRCm39) M366K probably benign Het
Rad54b T C 4: 11,601,702 (GRCm39) I419T probably damaging Het
Rnf43 A G 11: 87,622,108 (GRCm39) Q403R possibly damaging Het
Sema6a G A 18: 47,423,112 (GRCm39) probably null Het
Slc28a3 A G 13: 58,717,229 (GRCm39) probably benign Het
Smad2 A T 18: 76,422,108 (GRCm39) probably null Het
Smad4 G A 18: 73,791,720 (GRCm39) P274S probably benign Het
Smchd1 A T 17: 71,710,149 (GRCm39) V906D probably damaging Het
Soat2 C A 15: 102,067,188 (GRCm39) R320S possibly damaging Het
Spata33 C T 8: 123,948,626 (GRCm39) A57V probably damaging Het
Stab1 A G 14: 30,865,375 (GRCm39) L1814P probably benign Het
Stab2 T C 10: 86,783,008 (GRCm39) K680R probably benign Het
Stil A G 4: 114,898,369 (GRCm39) probably null Het
Sympk T A 7: 18,780,774 (GRCm39) L759H probably benign Het
Tet1 A T 10: 62,650,325 (GRCm39) probably null Het
Tfpi2 A T 6: 3,965,460 (GRCm39) N117K probably benign Het
Tle3 A G 9: 61,323,943 (GRCm39) Y766C probably damaging Het
Trpt1 C A 19: 6,975,298 (GRCm39) probably null Het
Tshz1 A G 18: 84,034,174 (GRCm39) F78S possibly damaging Het
Ttc1 T C 11: 43,629,635 (GRCm39) D177G probably damaging Het
Ttc13 T A 8: 125,401,140 (GRCm39) Y741F probably damaging Het
Ulk3 C T 9: 57,502,115 (GRCm39) S462L probably benign Het
Utrn C T 10: 12,401,077 (GRCm39) probably benign Het
V1rd19 A C 7: 23,703,010 (GRCm39) T159P probably damaging Het
Vars1 T C 17: 35,230,462 (GRCm39) V515A possibly damaging Het
Vmn1r85 A G 7: 12,818,515 (GRCm39) Y210H probably benign Het
Vmn2r89 A G 14: 51,693,435 (GRCm39) T262A probably damaging Het
Vps53 G A 11: 76,012,405 (GRCm39) T209I probably benign Het
Wdfy2 T C 14: 63,162,582 (GRCm39) F95L possibly damaging Het
Wwp1 G T 4: 19,627,911 (GRCm39) S694Y probably damaging Het
Zbtb8b T A 4: 129,326,463 (GRCm39) D201V probably damaging Het
Zmym5 A C 14: 57,041,908 (GRCm39) N123K possibly damaging Het
Other mutations in Klk1b26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Klk1b26 APN 7 43,666,309 (GRCm39) missense probably benign 0.00
IGL02179:Klk1b26 APN 7 43,665,736 (GRCm39) missense probably benign
IGL03190:Klk1b26 APN 7 43,662,151 (GRCm39) missense possibly damaging 0.76
R0483:Klk1b26 UTSW 7 43,665,772 (GRCm39) missense probably benign 0.15
R1499:Klk1b26 UTSW 7 43,665,810 (GRCm39) missense probably benign 0.22
R1549:Klk1b26 UTSW 7 43,665,826 (GRCm39) splice site probably benign
R1991:Klk1b26 UTSW 7 43,666,324 (GRCm39) missense probably damaging 0.99
R2103:Klk1b26 UTSW 7 43,666,324 (GRCm39) missense probably damaging 0.99
R2998:Klk1b26 UTSW 7 43,666,222 (GRCm39) missense probably benign 0.26
R3414:Klk1b26 UTSW 7 43,666,297 (GRCm39) missense probably benign
R4990:Klk1b26 UTSW 7 43,665,673 (GRCm39) splice site probably null
R4991:Klk1b26 UTSW 7 43,665,673 (GRCm39) splice site probably null
R5527:Klk1b26 UTSW 7 43,662,187 (GRCm39) missense probably benign 0.00
R5796:Klk1b26 UTSW 7 43,665,752 (GRCm39) missense probably damaging 1.00
R6816:Klk1b26 UTSW 7 43,666,292 (GRCm39) missense probably benign 0.00
R6938:Klk1b26 UTSW 7 43,665,718 (GRCm39) missense probably benign 0.00
R7197:Klk1b26 UTSW 7 43,665,821 (GRCm39) critical splice donor site probably null
R7243:Klk1b26 UTSW 7 43,666,337 (GRCm39) missense probably damaging 1.00
R7243:Klk1b26 UTSW 7 43,665,691 (GRCm39) missense not run
R7253:Klk1b26 UTSW 7 43,664,213 (GRCm39) missense possibly damaging 0.66
R7423:Klk1b26 UTSW 7 43,664,193 (GRCm39) missense probably damaging 0.99
R8270:Klk1b26 UTSW 7 43,665,544 (GRCm39) missense probably benign 0.08
R8342:Klk1b26 UTSW 7 43,665,508 (GRCm39) missense probably damaging 0.98
Z1088:Klk1b26 UTSW 7 43,665,420 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGCAATGGCAGGGCTTAGTCAG -3'
(R):5'- CCAGTGGCACCAGTGTGAGATTTAG -3'

Sequencing Primer
(F):5'- AAATCTCCTGAGGAGCCTCA -3'
(R):5'- TCGAGAGACATCTGAGGTCC -3'
Posted On 2014-05-08