Incidental Mutation 'R1347:Furin'
List |< first << previous [record 95 of 291] next >> last >|
ID186166
Institutional Source Beutler Lab
Gene Symbol Furin
Ensembl Gene ENSMUSG00000030530
Gene Namefurin (paired basic amino acid cleaving enzyme)
SynonymsPcsk3, PACE, SPC1, 9130404I01Rik, Fur
MMRRC Submission 039412-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1347 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location80388585-80405436 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 80392184 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080932] [ENSMUST00000107362] [ENSMUST00000120753] [ENSMUST00000122232] [ENSMUST00000205617] [ENSMUST00000206479] [ENSMUST00000206539] [ENSMUST00000206698] [ENSMUST00000206728] [ENSMUST00000206744]
Predicted Effect probably benign
Transcript: ENSMUST00000080932
SMART Domains Protein: ENSMUSP00000079733
Gene: ENSMUSG00000053158

DomainStartEndE-ValueType
FCH 1 94 2.22e-26 SMART
coiled coil region 133 165 N/A INTRINSIC
coiled coil region 320 344 N/A INTRINSIC
SH2 458 536 8.41e-26 SMART
TyrKc 561 814 1.57e-144 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107362
SMART Domains Protein: ENSMUSP00000102985
Gene: ENSMUSG00000030530

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
PDB:1KN6|A 27 107 4e-7 PDB
Pfam:Peptidase_S8 148 436 3.2e-62 PFAM
Pfam:P_proprotein 484 570 1.3e-33 PFAM
FU 577 620 4.67e-5 SMART
FU 638 681 2.13e-8 SMART
transmembrane domain 713 735 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120753
SMART Domains Protein: ENSMUSP00000113793
Gene: ENSMUSG00000030530

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:S8_pro-domain 33 107 5.8e-28 PFAM
Pfam:Peptidase_S8 144 427 9.1e-51 PFAM
Pfam:P_proprotein 484 570 4.4e-32 PFAM
FU 577 620 4.67e-5 SMART
FU 638 681 2.13e-8 SMART
transmembrane domain 713 735 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122232
SMART Domains Protein: ENSMUSP00000113370
Gene: ENSMUSG00000030530

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
PDB:1KN6|A 27 107 4e-7 PDB
Pfam:Peptidase_S8 148 436 3.2e-62 PFAM
Pfam:P_proprotein 484 570 1.3e-33 PFAM
FU 577 620 4.67e-5 SMART
FU 638 681 2.13e-8 SMART
transmembrane domain 713 735 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146771
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153446
Predicted Effect probably benign
Transcript: ENSMUST00000205617
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206271
Predicted Effect probably benign
Transcript: ENSMUST00000206352
Predicted Effect probably benign
Transcript: ENSMUST00000206479
Predicted Effect probably benign
Transcript: ENSMUST00000206539
Predicted Effect probably benign
Transcript: ENSMUST00000206698
Predicted Effect probably benign
Transcript: ENSMUST00000206728
Predicted Effect probably benign
Transcript: ENSMUST00000206744
Meta Mutation Damage Score 0.052 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a calcium-dependent serine endoprotease that proteolytically activates different proprotein substrates traversing the secretory pathway. The encoded protein undergoes proteolytic autoactivation during which an N-terminal propeptide is cleaved to generate the mature protein. Mice lacking the encoded protein die at an embryonic stage and display hemodynamic insufficiency, cardiac ventral closure defect, axial rotation defect and abnormal yolk sac vasculature. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygous null embryos die at E10.5-E11.5. Embryos homozygous for one knock-out allele show multiple tissue abnormalities including abnormal yolk sac vasculature and chorioallantoic fusion, failure of axial rotation, a kinked neural tube, exencephaly and severe ventral closure and cardiac defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932441B19Rik C T 13: 65,035,388 T248I probably benign Het
Ak5 G T 3: 152,533,434 D301E probably damaging Het
Arpc1a G T 5: 145,097,272 W150L probably damaging Het
Filip1l A G 16: 57,570,987 D646G probably damaging Het
Foxa1 A T 12: 57,542,284 H383Q probably damaging Het
Fpr-rs6 T C 17: 20,182,749 T117A probably benign Het
Fry A T 5: 150,495,818 E905V probably damaging Het
Glyr1 T C 16: 5,021,339 D338G probably damaging Het
Gpd2 A T 2: 57,357,671 K542M probably damaging Het
Itpr3 T C 17: 27,111,561 F1679L probably benign Het
Kif23 A G 9: 61,927,156 M427T probably damaging Het
Kpna1 T A 16: 36,009,326 I83N probably benign Het
Man2a1 T C 17: 64,712,450 F770L probably damaging Het
Mrpl44 T A 1: 79,777,952 F92I probably damaging Het
Myh4 A G 11: 67,244,741 probably benign Het
Olfr1458 T C 19: 13,102,690 I199V probably benign Het
Olfr444 A C 6: 42,955,705 D69A probably damaging Het
Rbm15 G T 3: 107,332,630 R151S possibly damaging Het
Rims3 G A 4: 120,883,125 G90S probably damaging Het
Rock2 G A 12: 16,977,624 C1314Y possibly damaging Het
Serpinb6e C T 13: 33,841,197 C37Y possibly damaging Het
Tbx15 C A 3: 99,352,111 Q433K possibly damaging Het
Vmn1r11 G A 6: 57,137,978 C209Y probably benign Het
Zfhx3 T C 8: 108,800,698 probably benign Het
Zim1 C A 7: 6,677,431 C411F probably damaging Het
Other mutations in Furin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Furin APN 7 80392567 missense probably damaging 1.00
IGL00910:Furin APN 7 80390996 missense probably benign
IGL01701:Furin APN 7 80392492 missense probably benign 0.11
IGL01701:Furin APN 7 80390759 missense probably benign 0.00
IGL01921:Furin APN 7 80395954 unclassified probably benign
IGL01981:Furin APN 7 80392899 missense probably damaging 1.00
IGL02035:Furin APN 7 80390987 missense probably benign
IGL02096:Furin APN 7 80393459 missense probably damaging 1.00
IGL02508:Furin APN 7 80392521 missense probably benign 0.01
IGL02611:Furin APN 7 80391778 missense probably benign 0.04
R0359:Furin UTSW 7 80391284 missense probably damaging 1.00
R0481:Furin UTSW 7 80393549 missense probably damaging 1.00
R0554:Furin UTSW 7 80391284 missense probably damaging 1.00
R1346:Furin UTSW 7 80392184 unclassified probably benign
R1373:Furin UTSW 7 80392184 unclassified probably benign
R1553:Furin UTSW 7 80398592 unclassified probably null
R1693:Furin UTSW 7 80392482 missense probably damaging 1.00
R4524:Furin UTSW 7 80398634 unclassified probably null
R4687:Furin UTSW 7 80393447 missense probably benign 0.00
R4869:Furin UTSW 7 80396979 missense probably damaging 1.00
R5249:Furin UTSW 7 80393421 missense probably damaging 1.00
R5498:Furin UTSW 7 80391794 missense probably damaging 1.00
R5708:Furin UTSW 7 80397855 intron probably benign
R6086:Furin UTSW 7 80395431 missense probably damaging 1.00
R6505:Furin UTSW 7 80393617 missense probably damaging 1.00
R6772:Furin UTSW 7 80393492 missense probably damaging 1.00
R6945:Furin UTSW 7 80391090 missense possibly damaging 0.82
R6954:Furin UTSW 7 80396964 missense possibly damaging 0.79
X0050:Furin UTSW 7 80395412 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGACACTTTTCACAAGGGACACAC -3'
(R):5'- CAAGTAAAGACTGGACCCTGAGCG -3'

Sequencing Primer
(F):5'- TCACAAGGGACACACACAGC -3'
(R):5'- TGACTCACGGTGCTTGC -3'
Posted On2014-05-09