Incidental Mutation 'R1347:Fpr-rs6'
ID186177
Institutional Source Beutler Lab
Gene Symbol Fpr-rs6
Ensembl Gene ENSMUSG00000071275
Gene Nameformyl peptide receptor, related sequence 6
Synonyms
MMRRC Submission 039412-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R1347 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location20182078-20183097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20182749 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 117 (T117A)
Ref Sequence ENSEMBL: ENSMUSP00000093296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095636]
Predicted Effect probably benign
Transcript: ENSMUST00000095636
AA Change: T117A

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000093296
Gene: ENSMUSG00000071275
AA Change: T117A

DomainStartEndE-ValueType
Pfam:7tm_1 43 297 5.7e-38 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932441B19Rik C T 13: 65,035,388 T248I probably benign Het
Ak5 G T 3: 152,533,434 D301E probably damaging Het
Arpc1a G T 5: 145,097,272 W150L probably damaging Het
Filip1l A G 16: 57,570,987 D646G probably damaging Het
Foxa1 A T 12: 57,542,284 H383Q probably damaging Het
Fry A T 5: 150,495,818 E905V probably damaging Het
Furin C T 7: 80,392,184 probably benign Het
Glyr1 T C 16: 5,021,339 D338G probably damaging Het
Gpd2 A T 2: 57,357,671 K542M probably damaging Het
Itpr3 T C 17: 27,111,561 F1679L probably benign Het
Kif23 A G 9: 61,927,156 M427T probably damaging Het
Kpna1 T A 16: 36,009,326 I83N probably benign Het
Man2a1 T C 17: 64,712,450 F770L probably damaging Het
Mrpl44 T A 1: 79,777,952 F92I probably damaging Het
Myh4 A G 11: 67,244,741 probably benign Het
Olfr1458 T C 19: 13,102,690 I199V probably benign Het
Olfr444 A C 6: 42,955,705 D69A probably damaging Het
Rbm15 G T 3: 107,332,630 R151S possibly damaging Het
Rims3 G A 4: 120,883,125 G90S probably damaging Het
Rock2 G A 12: 16,977,624 C1314Y possibly damaging Het
Serpinb6e C T 13: 33,841,197 C37Y possibly damaging Het
Tbx15 C A 3: 99,352,111 Q433K possibly damaging Het
Vmn1r11 G A 6: 57,137,978 C209Y probably benign Het
Zfhx3 T C 8: 108,800,698 probably benign Het
Zim1 C A 7: 6,677,431 C411F probably damaging Het
Other mutations in Fpr-rs6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02836:Fpr-rs6 APN 17 20183045 missense probably benign 0.30
IGL03380:Fpr-rs6 APN 17 20182983 missense possibly damaging 0.66
R0149:Fpr-rs6 UTSW 17 20182213 missense probably benign 0.29
R0190:Fpr-rs6 UTSW 17 20182479 missense probably benign 0.07
R1347:Fpr-rs6 UTSW 17 20182749 missense probably benign 0.23
R1934:Fpr-rs6 UTSW 17 20182890 missense probably benign 0.36
R1965:Fpr-rs6 UTSW 17 20182656 missense probably damaging 0.98
R3690:Fpr-rs6 UTSW 17 20182875 missense probably benign 0.02
R3963:Fpr-rs6 UTSW 17 20182217 missense probably damaging 1.00
R4564:Fpr-rs6 UTSW 17 20182906 nonsense probably null
R4574:Fpr-rs6 UTSW 17 20183097 start codon destroyed probably damaging 1.00
R5015:Fpr-rs6 UTSW 17 20182346 missense probably damaging 1.00
R5599:Fpr-rs6 UTSW 17 20182113 missense probably benign 0.05
R6737:Fpr-rs6 UTSW 17 20183077 missense probably benign 0.08
R6786:Fpr-rs6 UTSW 17 20182838 missense possibly damaging 0.95
R6908:Fpr-rs6 UTSW 17 20182439 missense probably damaging 1.00
R7040:Fpr-rs6 UTSW 17 20182934 missense probably damaging 1.00
R7462:Fpr-rs6 UTSW 17 20182223 missense probably damaging 1.00
R7673:Fpr-rs6 UTSW 17 20182737 missense probably benign 0.03
R8103:Fpr-rs6 UTSW 17 20182577 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TTGGCAGCCATGAGTCCATAACAG -3'
(R):5'- TGAACCTGGCATTGTCTGACTTCTC -3'

Sequencing Primer
(F):5'- TTGCAGCCCAGGATTCAAAATTAC -3'
(R):5'- CTTACATGGCAAGTCTACCATTTCAG -3'
Posted On2014-05-09