Mutagenetix > Incidental Mutation

Incidental Mutation 'R1571:Mrc1'

186184

Institutional Source

Beutler Lab

Gene Symbol

Mrc1

Ensembl Gene

ENSMUSG00000026712

Gene Name

mannose receptor, C type 1

Synonyms

CD206, MR

MMRRC Submission

039610-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.066) question?

Stock #

R1571 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

14234225-14336834 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 14313544 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 925 (H925L)

Ref Sequence

ENSEMBL: ENSMUSP00000028045 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028045]

AlphaFold

Q61830

PDB Structure

CRYSTAL STRUCTURE OF THE CYSTEINE RICH DOMAIN OF MANNOSE RECEPTOR [X-RAY DIFFRACTION]
Crystal structure of the cysteine rich domain of mannose receptor complexed with Acetylgalactosamine-4-sulfate [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(X) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(A) [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000028045
AA Change: H925L

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000028045
Gene: ENSMUSG00000026712
AA Change: H925L

Domain	Start	End	E-Value	Type
RICIN	22	142	8.09e-18	SMART
FN2	161	209	1.83e-27	SMART
CLECT	216	341	8.87e-26	SMART
CLECT	362	487	3.51e-38	SMART
CLECT	504	626	8.2e-30	SMART
CLECT	646	778	2.34e-34	SMART
CLECT	800	923	2.17e-29	SMART
low complexity region	935	941	N/A	INTRINSIC
CLECT	944	1079	3.35e-35	SMART
CLECT	1094	1212	4.11e-21	SMART
CLECT	1229	1355	3.63e-31	SMART
transmembrane domain	1388	1410	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The recognition of complex carbohydrate structures on glycoproteins is an important part of several biological processes, including cell-cell recognition, serum glycoprotein turnover, and neutralization of pathogens. The protein encoded by this gene is a type I membrane receptor that mediates the endocytosis of glycoproteins by macrophages. The protein has been shown to bind high-mannose structures on the surface of potentially pathogenic viruses, bacteria, and fungi so that they can be neutralized by phagocytic engulfment.[provided by RefSeq, Sep 2015]
PHENOTYPE: Male homozygotes for one targeted null mutation die in utero. Heterozygous females clear lutropin from the circulation more slowly and have smaller litters due to reduced implantation. Another targeted knockout is viable and homozygotes are less susceptible to parasitic infection. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610524H06Rik	A	G	5: 114,961,372 (GRCm39)		probably null	Het
Abcd3	T	C	3: 121,586,491 (GRCm39)	I70V	possibly damaging	Het
Acad10	T	C	5: 121,759,411 (GRCm39)	Y1024C	probably damaging	Het
Atp2b3	T	G	X: 72,588,712 (GRCm39)	V701G	probably damaging	Het
Cbfa2t2	T	A	2: 154,342,347 (GRCm39)	M21K	probably damaging	Het
Cdc25a	C	T	9: 109,710,614 (GRCm39)	T106I	possibly damaging	Het
Cdhr5	T	C	7: 140,852,083 (GRCm39)	T190A	probably damaging	Het
Chl1	A	G	6: 103,685,445 (GRCm39)	T829A	probably benign	Het
Clcn6	T	C	4: 148,097,226 (GRCm39)	T614A	possibly damaging	Het
Cntln	A	T	4: 84,865,823 (GRCm39)	R160*	probably null	Het
Dclk2	C	T	3: 86,712,946 (GRCm39)	R503Q	possibly damaging	Het
Dock3	C	A	9: 106,815,158 (GRCm39)	M1236I	possibly damaging	Het
Eif4g3	T	A	4: 137,847,719 (GRCm39)	H213Q	probably damaging	Het
Eya1	T	A	1: 14,279,141 (GRCm39)	H372L	probably damaging	Het
Fam13b	A	G	18: 34,630,485 (GRCm39)	V91A	possibly damaging	Het
Hat1	T	A	2: 71,264,519 (GRCm39)	I319K	probably benign	Het
Kcnf1	T	C	12: 17,225,853 (GRCm39)	N123D	probably benign	Het
Kcns3	C	A	12: 11,141,551 (GRCm39)	G383W	probably damaging	Het
Kprp	A	T	3: 92,732,689 (GRCm39)	C120*	probably null	Het
Lama3	T	A	18: 12,672,774 (GRCm39)	C2456S	probably damaging	Het
Lrp1b	A	T	2: 41,366,658 (GRCm39)	D539E	probably damaging	Het
Matn3	T	C	12: 9,005,466 (GRCm39)	L292S	probably damaging	Het
Mbd3l1	T	A	9: 18,395,947 (GRCm39)	I24N	probably damaging	Het
Med10	T	C	13: 69,958,159 (GRCm39)	L37P	probably damaging	Het
Myo15a	T	A	11: 60,409,290 (GRCm39)	I3219N	probably damaging	Het
Nom1	C	T	5: 29,647,633 (GRCm39)	Q623*	probably null	Het
Nrm	T	A	17: 36,175,079 (GRCm39)	W136R	probably damaging	Het
Or8h8	A	C	2: 86,753,789 (GRCm39)	V29G	probably benign	Het
Pde7b	T	C	10: 20,288,836 (GRCm39)	N298S	probably benign	Het
Piezo2	C	T	18: 63,277,990 (GRCm39)	A305T	possibly damaging	Het
Pimreg	T	C	11: 71,936,042 (GRCm39)	L175P	possibly damaging	Het
Pkhd1l1	A	G	15: 44,390,237 (GRCm39)	D1451G	probably benign	Het
Ptpro	A	G	6: 137,355,128 (GRCm39)	S212G	probably benign	Het
Rhpn1	C	T	15: 75,585,967 (GRCm39)	R627C	possibly damaging	Het
Rif1	GCCACCA	GCCA	2: 52,000,336 (GRCm39)		probably benign	Het
Rnase4	T	G	14: 51,342,497 (GRCm39)	F74V	probably damaging	Het
Sbno2	A	G	10: 79,896,226 (GRCm39)		probably null	Het
Selp	T	C	1: 163,954,176 (GRCm39)	Y159H	probably damaging	Het
Senp6	A	G	9: 80,000,853 (GRCm39)	T21A	probably damaging	Het
Slco1a7	A	T	6: 141,700,135 (GRCm39)	C132*	probably null	Het
Slco3a1	T	C	7: 74,154,128 (GRCm39)	D148G	possibly damaging	Het
Smtn	G	A	11: 3,480,102 (GRCm39)	P373L	probably benign	Het
Snx20	A	T	8: 89,356,597 (GRCm39)	L73Q	probably damaging	Het
Sobp	A	G	10: 43,033,942 (GRCm39)	V128A	possibly damaging	Het
Tcerg1	A	G	18: 42,657,357 (GRCm39)	T280A	unknown	Het
Tgfbrap1	A	G	1: 43,088,973 (GRCm39)	V810A	probably benign	Het
Thbs1	C	A	2: 117,949,678 (GRCm39)	D589E	probably damaging	Het
Tjp2	A	G	19: 24,078,239 (GRCm39)	Y885H	probably damaging	Het
Tmem109	A	G	19: 10,849,993 (GRCm39)	S100P	probably damaging	Het
Trim36	T	C	18: 46,305,562 (GRCm39)	K462E	probably benign	Het
Vmn1r226	A	T	17: 20,908,538 (GRCm39)	I257F	probably damaging	Het
Vmn2r92	A	G	17: 18,372,352 (GRCm39)	Y54C	probably damaging	Het
Wdcp	T	A	12: 4,901,924 (GRCm39)	Y593*	probably null	Het
Wdr59	T	C	8: 112,177,682 (GRCm39)	S907G	probably damaging	Het

Other mutations in Mrc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01013:Mrc1	APN	2	14,333,236 (GRCm39)	missense	probably damaging	1.00
IGL01326:Mrc1	APN	2	14,271,335 (GRCm39)	missense	probably damaging	1.00
IGL01340:Mrc1	APN	2	14,314,895 (GRCm39)	critical splice donor site	probably null
IGL01758:Mrc1	APN	2	14,243,059 (GRCm39)	missense	probably damaging	1.00
IGL01799:Mrc1	APN	2	14,243,187 (GRCm39)	missense	probably damaging	1.00
IGL02280:Mrc1	APN	2	14,249,024 (GRCm39)	missense	probably benign	0.19
IGL02435:Mrc1	APN	2	14,253,671 (GRCm39)	nonsense	probably null
IGL03073:Mrc1	APN	2	14,310,153 (GRCm39)	missense	probably damaging	1.00
IGL03110:Mrc1	APN	2	14,298,289 (GRCm39)	nonsense	probably null
IGL03155:Mrc1	APN	2	14,335,912 (GRCm39)	missense	probably benign	0.00
IGL03289:Mrc1	APN	2	14,313,634 (GRCm39)	critical splice donor site	probably null
amlodipine	UTSW	2	14,275,016 (GRCm39)	missense	probably damaging	1.00
losartan	UTSW	2	14,299,597 (GRCm39)	splice site	probably null
Shug	UTSW	2	14,275,017 (GRCm39)	missense	probably damaging	1.00
sussigkeit	UTSW	2	14,330,192 (GRCm39)	splice site	probably null
R0011:Mrc1	UTSW	2	14,266,148 (GRCm39)	critical splice donor site	probably null
R0011:Mrc1	UTSW	2	14,266,148 (GRCm39)	critical splice donor site	probably null
R0066:Mrc1	UTSW	2	14,266,011 (GRCm39)	missense	probably benign	0.42
R0066:Mrc1	UTSW	2	14,266,011 (GRCm39)	missense	probably benign	0.42
R0110:Mrc1	UTSW	2	14,243,353 (GRCm39)	splice site	probably benign
R0234:Mrc1	UTSW	2	14,284,705 (GRCm39)	missense	possibly damaging	0.65
R0234:Mrc1	UTSW	2	14,284,705 (GRCm39)	missense	possibly damaging	0.65
R0381:Mrc1	UTSW	2	14,312,720 (GRCm39)	missense	probably benign	0.05
R0505:Mrc1	UTSW	2	14,314,843 (GRCm39)	missense	probably damaging	1.00
R0539:Mrc1	UTSW	2	14,274,937 (GRCm39)	splice site	probably benign
R0613:Mrc1	UTSW	2	14,299,630 (GRCm39)	missense	probably damaging	0.96
R0626:Mrc1	UTSW	2	14,333,382 (GRCm39)	nonsense	probably null
R1122:Mrc1	UTSW	2	14,266,147 (GRCm39)	critical splice donor site	probably null
R1281:Mrc1	UTSW	2	14,298,321 (GRCm39)	missense	probably damaging	1.00
R1399:Mrc1	UTSW	2	14,284,736 (GRCm39)	missense	probably damaging	1.00
R1428:Mrc1	UTSW	2	14,320,074 (GRCm39)	missense	probably benign	0.11
R1596:Mrc1	UTSW	2	14,253,701 (GRCm39)	missense	possibly damaging	0.91
R1730:Mrc1	UTSW	2	14,332,655 (GRCm39)	missense	probably benign	0.01
R1733:Mrc1	UTSW	2	14,261,910 (GRCm39)	missense	probably damaging	1.00
R1783:Mrc1	UTSW	2	14,332,655 (GRCm39)	missense	probably benign	0.01
R1860:Mrc1	UTSW	2	14,333,390 (GRCm39)	missense	probably benign	0.30
R1872:Mrc1	UTSW	2	14,330,192 (GRCm39)	splice site	probably null
R1889:Mrc1	UTSW	2	14,313,488 (GRCm39)	critical splice acceptor site	probably null
R1938:Mrc1	UTSW	2	14,324,052 (GRCm39)	missense	possibly damaging	0.89
R1971:Mrc1	UTSW	2	14,249,103 (GRCm39)	critical splice donor site	probably null
R2031:Mrc1	UTSW	2	14,326,584 (GRCm39)	missense	probably damaging	1.00
R2136:Mrc1	UTSW	2	14,275,000 (GRCm39)	missense	probably damaging	1.00
R2152:Mrc1	UTSW	2	14,332,675 (GRCm39)	missense	probably damaging	1.00
R2168:Mrc1	UTSW	2	14,249,015 (GRCm39)	missense	possibly damaging	0.90
R2273:Mrc1	UTSW	2	14,330,183 (GRCm39)	missense	probably damaging	1.00
R2901:Mrc1	UTSW	2	14,333,354 (GRCm39)	missense	possibly damaging	0.94
R3767:Mrc1	UTSW	2	14,323,981 (GRCm39)	missense	probably damaging	1.00
R3795:Mrc1	UTSW	2	14,293,793 (GRCm39)	splice site	probably benign
R4028:Mrc1	UTSW	2	14,243,059 (GRCm39)	missense	probably damaging	1.00
R4668:Mrc1	UTSW	2	14,298,297 (GRCm39)	missense	probably damaging	1.00
R4828:Mrc1	UTSW	2	14,275,017 (GRCm39)	missense	probably damaging	1.00
R4897:Mrc1	UTSW	2	14,323,952 (GRCm39)	missense	probably benign	0.01
R4950:Mrc1	UTSW	2	14,276,091 (GRCm39)	missense	probably damaging	1.00
R5000:Mrc1	UTSW	2	14,249,000 (GRCm39)	missense	probably damaging	1.00
R5068:Mrc1	UTSW	2	14,311,327 (GRCm39)	missense	probably benign	0.00
R5279:Mrc1	UTSW	2	14,314,869 (GRCm39)	missense	probably damaging	0.99
R5366:Mrc1	UTSW	2	14,326,725 (GRCm39)	missense	probably benign	0.03
R5436:Mrc1	UTSW	2	14,271,326 (GRCm39)	missense	probably damaging	1.00
R5552:Mrc1	UTSW	2	14,284,768 (GRCm39)	missense	probably benign	0.05
R5631:Mrc1	UTSW	2	14,333,383 (GRCm39)	nonsense	probably null
R5831:Mrc1	UTSW	2	14,313,523 (GRCm39)	missense	probably damaging	0.99
R5978:Mrc1	UTSW	2	14,320,204 (GRCm39)	missense	probably damaging	0.97
R5993:Mrc1	UTSW	2	14,310,138 (GRCm39)	missense	probably damaging	1.00
R6030:Mrc1	UTSW	2	14,321,712 (GRCm39)	missense	probably benign	0.04
R6030:Mrc1	UTSW	2	14,321,712 (GRCm39)	missense	probably benign	0.04
R6038:Mrc1	UTSW	2	14,261,882 (GRCm39)	missense	probably damaging	1.00
R6038:Mrc1	UTSW	2	14,261,882 (GRCm39)	missense	probably damaging	1.00
R6228:Mrc1	UTSW	2	14,276,115 (GRCm39)	missense	probably benign	0.08
R6344:Mrc1	UTSW	2	14,248,985 (GRCm39)	missense	probably damaging	1.00
R6457:Mrc1	UTSW	2	14,275,016 (GRCm39)	missense	probably damaging	1.00
R6520:Mrc1	UTSW	2	14,312,760 (GRCm39)	missense	probably damaging	1.00
R6619:Mrc1	UTSW	2	14,299,597 (GRCm39)	splice site	probably null
R6631:Mrc1	UTSW	2	14,243,296 (GRCm39)	missense	probably benign
R6737:Mrc1	UTSW	2	14,276,088 (GRCm39)	missense	possibly damaging	0.95
R6782:Mrc1	UTSW	2	14,266,148 (GRCm39)	critical splice donor site	probably null
R6887:Mrc1	UTSW	2	14,330,048 (GRCm39)	missense	possibly damaging	0.94
R7108:Mrc1	UTSW	2	14,308,957 (GRCm39)	nonsense	probably null
R7120:Mrc1	UTSW	2	14,313,508 (GRCm39)	missense	probably damaging	0.97
R7460:Mrc1	UTSW	2	14,253,680 (GRCm39)	missense	probably damaging	1.00
R7567:Mrc1	UTSW	2	14,330,104 (GRCm39)	missense	probably damaging	1.00
R7606:Mrc1	UTSW	2	14,242,955 (GRCm39)	missense	probably damaging	1.00
R7725:Mrc1	UTSW	2	14,284,788 (GRCm39)	missense	probably benign	0.03
R7826:Mrc1	UTSW	2	14,299,668 (GRCm39)	missense	probably damaging	1.00
R8082:Mrc1	UTSW	2	14,253,771 (GRCm39)	missense	probably benign
R8279:Mrc1	UTSW	2	14,271,168 (GRCm39)	missense	possibly damaging	0.89
R8888:Mrc1	UTSW	2	14,312,760 (GRCm39)	missense	probably damaging	1.00
R8895:Mrc1	UTSW	2	14,312,760 (GRCm39)	missense	probably damaging	1.00
R8952:Mrc1	UTSW	2	14,253,735 (GRCm39)	missense	probably damaging	0.98
R9315:Mrc1	UTSW	2	14,248,969 (GRCm39)	nonsense	probably null
R9366:Mrc1	UTSW	2	14,321,709 (GRCm39)	missense	probably damaging	0.99
R9373:Mrc1	UTSW	2	14,274,999 (GRCm39)	missense	probably damaging	0.99
R9418:Mrc1	UTSW	2	14,234,358 (GRCm39)	missense	probably benign	0.12
R9420:Mrc1	UTSW	2	14,312,790 (GRCm39)	missense	possibly damaging	0.53
R9489:Mrc1	UTSW	2	14,324,110 (GRCm39)	missense	probably benign	0.06
R9564:Mrc1	UTSW	2	14,266,117 (GRCm39)	missense	probably benign	0.00
R9572:Mrc1	UTSW	2	14,234,334 (GRCm39)	missense	probably benign
R9605:Mrc1	UTSW	2	14,324,110 (GRCm39)	missense	probably benign	0.06
R9606:Mrc1	UTSW	2	14,313,517 (GRCm39)	missense	probably benign	0.01
R9781:Mrc1	UTSW	2	14,310,175 (GRCm39)	missense	possibly damaging	0.90
R9781:Mrc1	UTSW	2	14,249,100 (GRCm39)	missense	probably benign
Z1177:Mrc1	UTSW	2	14,293,927 (GRCm39)	missense	probably damaging	1.00
Z1177:Mrc1	UTSW	2	14,248,949 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAACCATTTTCTGAGATCCCTCCTGA -3'
(R):5'- CCTGCTCTGCTCTGATAGACTGTGT -3'

Sequencing Primer
(F):5'- CTGAGATCCCTCCTGAGATATTG -3'
(R):5'- AGACTGTGTCCTCCGAAATAG -3'

Posted On

2014-05-09