Mutagenetix > Incidental Mutation

Incidental Mutation 'R1571:Dclk2'

186192

Institutional Source

Beutler Lab

Gene Symbol

Dclk2

Ensembl Gene

ENSMUSG00000028078

Gene Name

doublecortin-like kinase 2

Synonyms

Dcamkl2, Click-II, 6330415M09Rik

MMRRC Submission

039610-MU

Accession Numbers

Genbank: NM_027539; MGI: 1918012

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1571 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86786151-86920852 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 86805639 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 503 (R503Q)

Ref Sequence

ENSEMBL: ENSMUSP00000141707 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029719] [ENSMUST00000191752] [ENSMUST00000192773] [ENSMUST00000193632] [ENSMUST00000194452] [ENSMUST00000195561]

AlphaFold

Q6PGN3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029719
AA Change: R503Q

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000029719
Gene: ENSMUSG00000028078
AA Change: R503Q

Domain	Start	End	E-Value	Type
low complexity region	18	43	N/A	INTRINSIC
DCX	67	158	2.29e-42	SMART
DCX	191	279	2.17e-34	SMART
low complexity region	291	317	N/A	INTRINSIC
low complexity region	323	346	N/A	INTRINSIC
S_TKc	393	650	4.96e-101	SMART
low complexity region	718	740	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000191752
AA Change: R503Q

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000141707
Gene: ENSMUSG00000028078
AA Change: R503Q

Domain	Start	End	E-Value	Type
low complexity region	18	43	N/A	INTRINSIC
DCX	67	158	2.29e-42	SMART
DCX	191	279	2.17e-34	SMART
low complexity region	291	317	N/A	INTRINSIC
low complexity region	323	346	N/A	INTRINSIC
S_TKc	393	646	2.4e-76	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000192773
AA Change: R502Q

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000141567
Gene: ENSMUSG00000028078
AA Change: R502Q

Domain	Start	End	E-Value	Type
low complexity region	18	43	N/A	INTRINSIC
DCX	67	158	1.1e-44	SMART
DCX	191	279	9.9e-37	SMART
low complexity region	291	317	N/A	INTRINSIC
low complexity region	323	346	N/A	INTRINSIC
S_TKc	392	641	8.6e-81	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000193632
AA Change: R519Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000141866
Gene: ENSMUSG00000028078
AA Change: R519Q

Domain	Start	End	E-Value	Type
low complexity region	18	43	N/A	INTRINSIC
DCX	67	158	1.1e-44	SMART
DCX	191	279	9.9e-37	SMART
low complexity region	291	317	N/A	INTRINSIC
low complexity region	339	362	N/A	INTRINSIC
S_TKc	409	666	2.4e-103	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000194452
AA Change: R502Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000141816
Gene: ENSMUSG00000028078
AA Change: R502Q

Domain	Start	End	E-Value	Type
low complexity region	18	43	N/A	INTRINSIC
DCX	67	158	2.29e-42	SMART
DCX	191	279	2.17e-34	SMART
low complexity region	291	317	N/A	INTRINSIC
low complexity region	323	346	N/A	INTRINSIC
Pfam:Pkinase_Tyr	392	590	2.2e-31	PFAM
Pfam:Pkinase	392	591	4.7e-59	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000195561
AA Change: R502Q

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000142267
Gene: ENSMUSG00000028078
AA Change: R502Q

Domain	Start	End	E-Value	Type
low complexity region	18	43	N/A	INTRINSIC
DCX	67	158	2.29e-42	SMART
DCX	191	279	2.17e-34	SMART
low complexity region	291	317	N/A	INTRINSIC
low complexity region	323	346	N/A	INTRINSIC
S_TKc	392	649	4.96e-101	SMART
low complexity region	717	739	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the protein kinase superfamily and the doublecortin family. The protein encoded by this gene contains two N-terminal doublecortin domains, which bind microtubules and regulate microtubule polymerization, a C-terminal serine/threonine protein kinase domain, which shows substantial homology to Ca2+/calmoduline-dependent protein kinase, and a serine/proline-rich domain in between the doublecortin and the protein kinase domains, which mediates multiple protein-protein interactions. The microtubule-polymerizing activity of the encoded protein is independent of its protein kinase activity. This gene and the DCX gene, another family member, share function in the establishment of hippocampal organization and their absence results in a severe epileptic phenotype and lethality, as described in human patients with lissencephaly. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Sep 2010]

Allele List at MGI

All alleles(59) : Targeted, knock-out(1) Gene trapped(58)

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610524H06Rik	A	G	5: 114,823,311		probably null	Het
Abcd3	T	C	3: 121,792,842	I70V	possibly damaging	Het
Acad10	T	C	5: 121,621,348	Y1024C	probably damaging	Het
Atp2b3	T	G	X: 73,545,106	V701G	probably damaging	Het
Cbfa2t2	T	A	2: 154,500,427	M21K	probably damaging	Het
Cdc25a	C	T	9: 109,881,546	T106I	possibly damaging	Het
Cdhr5	T	C	7: 141,272,170	T190A	probably damaging	Het
Chl1	A	G	6: 103,708,484	T829A	probably benign	Het
Clcn6	T	C	4: 148,012,769	T614A	possibly damaging	Het
Cntln	A	T	4: 84,947,586	R160*	probably null	Het
Dock3	C	A	9: 106,937,959	M1236I	possibly damaging	Het
Eif4g3	T	A	4: 138,120,408	H213Q	probably damaging	Het
Eya1	T	A	1: 14,208,917	H372L	probably damaging	Het
Fam13b	A	G	18: 34,497,432	V91A	possibly damaging	Het
Gm5724	A	T	6: 141,754,409	C132*	probably null	Het
Hat1	T	A	2: 71,434,175	I319K	probably benign	Het
Kcnf1	T	C	12: 17,175,852	N123D	probably benign	Het
Kcns3	C	A	12: 11,091,550	G383W	probably damaging	Het
Kprp	A	T	3: 92,825,382	C120*	probably null	Het
Lama3	T	A	18: 12,539,717	C2456S	probably damaging	Het
Lrp1b	A	T	2: 41,476,646	D539E	probably damaging	Het
Matn3	T	C	12: 8,955,466	L292S	probably damaging	Het
Mbd3l1	T	A	9: 18,484,651	I24N	probably damaging	Het
Med10	T	C	13: 69,810,040	L37P	probably damaging	Het
Mrc1	A	T	2: 14,308,733	H925L	probably damaging	Het
Myo15	T	A	11: 60,518,464	I3219N	probably damaging	Het
Nom1	C	T	5: 29,442,635	Q623*	probably null	Het
Nrm	T	A	17: 35,864,187	W136R	probably damaging	Het
Olfr1098	A	C	2: 86,923,445	V29G	probably benign	Het
Pde7b	T	C	10: 20,413,090	N298S	probably benign	Het
Piezo2	C	T	18: 63,144,919	A305T	possibly damaging	Het
Pimreg	T	C	11: 72,045,216	L175P	possibly damaging	Het
Pkhd1l1	A	G	15: 44,526,841	D1451G	probably benign	Het
Ptpro	A	G	6: 137,378,130	S212G	probably benign	Het
Rhpn1	C	T	15: 75,714,118	R627C	possibly damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rnase4	T	G	14: 51,105,040	F74V	probably damaging	Het
Sbno2	A	G	10: 80,060,392		probably null	Het
Selp	T	C	1: 164,126,607	Y159H	probably damaging	Het
Senp6	A	G	9: 80,093,571	T21A	probably damaging	Het
Slco3a1	T	C	7: 74,504,380	D148G	possibly damaging	Het
Smtn	G	A	11: 3,530,102	P373L	probably benign	Het
Snx20	A	T	8: 88,629,969	L73Q	probably damaging	Het
Sobp	A	G	10: 43,157,946	V128A	possibly damaging	Het
Tcerg1	A	G	18: 42,524,292	T280A	unknown	Het
Tgfbrap1	A	G	1: 43,049,813	V810A	probably benign	Het
Thbs1	C	A	2: 118,119,197	D589E	probably damaging	Het
Tjp2	A	G	19: 24,100,875	Y885H	probably damaging	Het
Tmem109	A	G	19: 10,872,629	S100P	probably damaging	Het
Trim36	T	C	18: 46,172,495	K462E	probably benign	Het
Vmn1r226	A	T	17: 20,688,276	I257F	probably damaging	Het
Vmn2r92	A	G	17: 18,152,090	Y54C	probably damaging	Het
Wdcp	T	A	12: 4,851,924	Y593*	probably null	Het
Wdr59	T	C	8: 111,451,050	S907G	probably damaging	Het

Other mutations in Dclk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Dclk2	APN	3	86799090	critical splice acceptor site	probably null
IGL01769:Dclk2	APN	3	86816360	missense	possibly damaging	0.50
IGL01802:Dclk2	APN	3	86799027	missense	probably damaging	1.00
IGL02296:Dclk2	APN	3	86793293	missense	probably damaging	1.00
IGL02390:Dclk2	APN	3	86824683	missense	probably damaging	0.99
IGL02522:Dclk2	APN	3	86920116	missense	probably benign	0.01
IGL03104:Dclk2	APN	3	86836359	missense	probably damaging	1.00
IGL03337:Dclk2	APN	3	86906059	missense	probably damaging	1.00
R0219:Dclk2	UTSW	3	86813669	splice site	probably benign
R0400:Dclk2	UTSW	3	86813747	splice site	probably null
R0606:Dclk2	UTSW	3	86906004	missense	probably damaging	1.00
R1537:Dclk2	UTSW	3	86806184	missense	probably damaging	0.97
R1569:Dclk2	UTSW	3	86805639	missense	possibly damaging	0.50
R1612:Dclk2	UTSW	3	86805639	missense	possibly damaging	0.50
R1680:Dclk2	UTSW	3	86805639	missense	possibly damaging	0.50
R1689:Dclk2	UTSW	3	86805639	missense	possibly damaging	0.50
R1714:Dclk2	UTSW	3	86906093	missense	probably benign	0.00
R1745:Dclk2	UTSW	3	86805639	missense	possibly damaging	0.50
R1746:Dclk2	UTSW	3	86805639	missense	possibly damaging	0.50
R1752:Dclk2	UTSW	3	86806127	missense	possibly damaging	0.61
R1829:Dclk2	UTSW	3	86805639	missense	possibly damaging	0.50
R2008:Dclk2	UTSW	3	86920035	missense	probably damaging	1.00
R2125:Dclk2	UTSW	3	86805639	missense	possibly damaging	0.50
R2126:Dclk2	UTSW	3	86805639	missense	possibly damaging	0.50
R2132:Dclk2	UTSW	3	86920046	missense	probably benign	0.44
R2314:Dclk2	UTSW	3	86920035	missense	probably damaging	1.00
R2338:Dclk2	UTSW	3	86799017	missense	probably damaging	1.00
R2849:Dclk2	UTSW	3	86793223	missense	probably damaging	1.00
R3108:Dclk2	UTSW	3	86920035	missense	probably damaging	1.00
R3109:Dclk2	UTSW	3	86920035	missense	probably damaging	1.00
R3615:Dclk2	UTSW	3	86920035	missense	probably damaging	1.00
R3616:Dclk2	UTSW	3	86920035	missense	probably damaging	1.00
R4051:Dclk2	UTSW	3	86830822	critical splice donor site	probably null
R4052:Dclk2	UTSW	3	86830822	critical splice donor site	probably null
R4208:Dclk2	UTSW	3	86830822	critical splice donor site	probably null
R4643:Dclk2	UTSW	3	86806180	missense	possibly damaging	0.93
R4654:Dclk2	UTSW	3	86836376	missense	probably damaging	1.00
R4693:Dclk2	UTSW	3	86815093	missense	possibly damaging	0.67
R4716:Dclk2	UTSW	3	86919881	missense	probably damaging	1.00
R4914:Dclk2	UTSW	3	86824742	splice site	probably null
R4915:Dclk2	UTSW	3	86824742	splice site	probably null
R4917:Dclk2	UTSW	3	86824742	splice site	probably null
R5218:Dclk2	UTSW	3	86805678	missense	probably damaging	1.00
R5510:Dclk2	UTSW	3	86906037	missense	possibly damaging	0.93
R5520:Dclk2	UTSW	3	86919840	missense	probably damaging	1.00
R5867:Dclk2	UTSW	3	86791859	makesense	probably null
R5976:Dclk2	UTSW	3	86787225	missense	possibly damaging	0.53
R6048:Dclk2	UTSW	3	86905965	missense	probably damaging	1.00
R6111:Dclk2	UTSW	3	86805661	missense	probably benign	0.28
R6192:Dclk2	UTSW	3	86815150	missense	probably damaging	1.00
R6289:Dclk2	UTSW	3	86831817	missense	probably benign	0.18
R6595:Dclk2	UTSW	3	86792067	critical splice donor site	probably benign
R6897:Dclk2	UTSW	3	86831763	missense	probably benign	0.00
R7061:Dclk2	UTSW	3	86831731	critical splice donor site	probably null
R7095:Dclk2	UTSW	3	86793259	missense	probably damaging	1.00
R7096:Dclk2	UTSW	3	86793259	missense	probably damaging	1.00
R7208:Dclk2	UTSW	3	86799602	splice site	probably null
R7253:Dclk2	UTSW	3	86793259	missense	probably damaging	1.00
R7256:Dclk2	UTSW	3	86793259	missense	probably damaging	1.00
R8003:Dclk2	UTSW	3	86793301	critical splice acceptor site	probably null
R8061:Dclk2	UTSW	3	86813674	splice site	probably benign
R8927:Dclk2	UTSW	3	86831741	missense	probably damaging	1.00
R8928:Dclk2	UTSW	3	86831741	missense	probably damaging	1.00
R8964:Dclk2	UTSW	3	86836391	missense	probably damaging	1.00
R9704:Dclk2	UTSW	3	86920080	missense	possibly damaging	0.66

Predicted Primers

PCR Primer
(F):5'- ACGTATGCACTGATTCAAGATGCCC -3'
(R):5'- TCTTCTGCAAACTGATGTGACACCC -3'

Sequencing Primer
(F):5'- CACTGATTCAAGATGCCCATTAGG -3'
(R):5'- CTTCTTATTTCAGAGGACCGAACTG -3'

Posted On

2014-05-09