Mutagenetix > Incidental Mutation

Incidental Mutation 'R1571:Cntln'

186195

Institutional Source

Beutler Lab

Gene Symbol

Cntln

Ensembl Gene

ENSMUSG00000038070

Gene Name

centlein, centrosomal protein

Synonyms

B430108F07Rik, D530005L17Rik

MMRRC Submission

039610-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.240) question?

Stock #

R1571 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

84884309-85131921 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 84947586 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 160 (R160*)

Ref Sequence

ENSEMBL: ENSMUSP00000130491 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000102819] [ENSMUST00000169371]

AlphaFold

A2AM05

Predicted Effect

probably null
Transcript: ENSMUST00000047023
AA Change: R160*

SMART Domains

Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070
AA Change: R160*

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	58	86	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
internal_repeat_1	198	219	1.25e-5	PROSPERO
low complexity region	242	251	N/A	INTRINSIC
internal_repeat_1	321	342	1.25e-5	PROSPERO
low complexity region	346	358	N/A	INTRINSIC
coiled coil region	404	433	N/A	INTRINSIC
low complexity region	434	446	N/A	INTRINSIC
coiled coil region	458	481	N/A	INTRINSIC
coiled coil region	516	584	N/A	INTRINSIC
coiled coil region	606	648	N/A	INTRINSIC
coiled coil region	674	780	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
coiled coil region	973	1114	N/A	INTRINSIC
low complexity region	1206	1217	N/A	INTRINSIC
Blast:HisKA	1270	1326	1e-24	BLAST
low complexity region	1327	1348	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000102819
AA Change: R160*

SMART Domains

Protein: ENSMUSP00000099883
Gene: ENSMUSG00000038070
AA Change: R160*

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	58	86	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
coiled coil region	166	277	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000169371
AA Change: R160*

SMART Domains

Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070
AA Change: R160*

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	58	86	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
internal_repeat_1	198	219	1.24e-5	PROSPERO
low complexity region	242	251	N/A	INTRINSIC
internal_repeat_1	321	342	1.24e-5	PROSPERO
low complexity region	346	358	N/A	INTRINSIC
coiled coil region	404	433	N/A	INTRINSIC
low complexity region	434	446	N/A	INTRINSIC
coiled coil region	458	481	N/A	INTRINSIC
coiled coil region	516	584	N/A	INTRINSIC
coiled coil region	606	648	N/A	INTRINSIC
coiled coil region	674	780	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
coiled coil region	972	1113	N/A	INTRINSIC
low complexity region	1205	1216	N/A	INTRINSIC
Blast:HisKA	1269	1325	1e-24	BLAST
low complexity region	1326	1347	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610524H06Rik	A	G	5: 114,823,311		probably null	Het
Abcd3	T	C	3: 121,792,842	I70V	possibly damaging	Het
Acad10	T	C	5: 121,621,348	Y1024C	probably damaging	Het
Atp2b3	T	G	X: 73,545,106	V701G	probably damaging	Het
Cbfa2t2	T	A	2: 154,500,427	M21K	probably damaging	Het
Cdc25a	C	T	9: 109,881,546	T106I	possibly damaging	Het
Cdhr5	T	C	7: 141,272,170	T190A	probably damaging	Het
Chl1	A	G	6: 103,708,484	T829A	probably benign	Het
Clcn6	T	C	4: 148,012,769	T614A	possibly damaging	Het
Dclk2	C	T	3: 86,805,639	R503Q	possibly damaging	Het
Dock3	C	A	9: 106,937,959	M1236I	possibly damaging	Het
Eif4g3	T	A	4: 138,120,408	H213Q	probably damaging	Het
Eya1	T	A	1: 14,208,917	H372L	probably damaging	Het
Fam13b	A	G	18: 34,497,432	V91A	possibly damaging	Het
Gm5724	A	T	6: 141,754,409	C132*	probably null	Het
Hat1	T	A	2: 71,434,175	I319K	probably benign	Het
Kcnf1	T	C	12: 17,175,852	N123D	probably benign	Het
Kcns3	C	A	12: 11,091,550	G383W	probably damaging	Het
Kprp	A	T	3: 92,825,382	C120*	probably null	Het
Lama3	T	A	18: 12,539,717	C2456S	probably damaging	Het
Lrp1b	A	T	2: 41,476,646	D539E	probably damaging	Het
Matn3	T	C	12: 8,955,466	L292S	probably damaging	Het
Mbd3l1	T	A	9: 18,484,651	I24N	probably damaging	Het
Med10	T	C	13: 69,810,040	L37P	probably damaging	Het
Mrc1	A	T	2: 14,308,733	H925L	probably damaging	Het
Myo15	T	A	11: 60,518,464	I3219N	probably damaging	Het
Nom1	C	T	5: 29,442,635	Q623*	probably null	Het
Nrm	T	A	17: 35,864,187	W136R	probably damaging	Het
Olfr1098	A	C	2: 86,923,445	V29G	probably benign	Het
Pde7b	T	C	10: 20,413,090	N298S	probably benign	Het
Piezo2	C	T	18: 63,144,919	A305T	possibly damaging	Het
Pimreg	T	C	11: 72,045,216	L175P	possibly damaging	Het
Pkhd1l1	A	G	15: 44,526,841	D1451G	probably benign	Het
Ptpro	A	G	6: 137,378,130	S212G	probably benign	Het
Rhpn1	C	T	15: 75,714,118	R627C	possibly damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rnase4	T	G	14: 51,105,040	F74V	probably damaging	Het
Sbno2	A	G	10: 80,060,392		probably null	Het
Selp	T	C	1: 164,126,607	Y159H	probably damaging	Het
Senp6	A	G	9: 80,093,571	T21A	probably damaging	Het
Slco3a1	T	C	7: 74,504,380	D148G	possibly damaging	Het
Smtn	G	A	11: 3,530,102	P373L	probably benign	Het
Snx20	A	T	8: 88,629,969	L73Q	probably damaging	Het
Sobp	A	G	10: 43,157,946	V128A	possibly damaging	Het
Tcerg1	A	G	18: 42,524,292	T280A	unknown	Het
Tgfbrap1	A	G	1: 43,049,813	V810A	probably benign	Het
Thbs1	C	A	2: 118,119,197	D589E	probably damaging	Het
Tjp2	A	G	19: 24,100,875	Y885H	probably damaging	Het
Tmem109	A	G	19: 10,872,629	S100P	probably damaging	Het
Trim36	T	C	18: 46,172,495	K462E	probably benign	Het
Vmn1r226	A	T	17: 20,688,276	I257F	probably damaging	Het
Vmn2r92	A	G	17: 18,152,090	Y54C	probably damaging	Het
Wdcp	T	A	12: 4,851,924	Y593*	probably null	Het
Wdr59	T	C	8: 111,451,050	S907G	probably damaging	Het

Other mutations in Cntln

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00639:Cntln	APN	4	85006434	missense	probably benign	0.25
IGL00743:Cntln	APN	4	84979415	missense	probably benign	0.06
IGL01014:Cntln	APN	4	85049908	missense	probably benign	0.25
IGL02217:Cntln	APN	4	85100258	missense	probably damaging	1.00
IGL02323:Cntln	APN	4	85049789	missense	probably benign	0.00
IGL02353:Cntln	APN	4	85049850	missense	probably damaging	0.98
IGL02360:Cntln	APN	4	85049850	missense	probably damaging	0.98
IGL02616:Cntln	APN	4	85115452	critical splice donor site	probably null
PIT4696001:Cntln	UTSW	4	84974000	missense	probably damaging	0.99
R0110:Cntln	UTSW	4	85096757	missense	probably damaging	1.00
R0324:Cntln	UTSW	4	85092695	missense	probably damaging	0.98
R0349:Cntln	UTSW	4	84996485	missense	probably damaging	1.00
R0519:Cntln	UTSW	4	85005053	splice site	probably benign
R0529:Cntln	UTSW	4	85067825	missense	probably damaging	1.00
R0582:Cntln	UTSW	4	84884741	missense	probably damaging	1.00
R1077:Cntln	UTSW	4	84996479	missense	probably damaging	1.00
R1345:Cntln	UTSW	4	84973991	missense	probably damaging	1.00
R1457:Cntln	UTSW	4	85096839	missense	probably benign	0.33
R1622:Cntln	UTSW	4	85063181	missense	probably damaging	1.00
R1681:Cntln	UTSW	4	84947635	missense	probably damaging	1.00
R1777:Cntln	UTSW	4	85130679	missense	probably benign	0.23
R1808:Cntln	UTSW	4	85096763	missense	probably damaging	1.00
R1882:Cntln	UTSW	4	85100835	missense	probably damaging	1.00
R2056:Cntln	UTSW	4	85049674	missense	probably benign
R2965:Cntln	UTSW	4	84974027	critical splice donor site	probably null
R2968:Cntln	UTSW	4	84957267	missense	probably benign	0.27
R3104:Cntln	UTSW	4	84957169	missense	possibly damaging	0.95
R3106:Cntln	UTSW	4	84957169	missense	possibly damaging	0.95
R3121:Cntln	UTSW	4	85005052	splice site	probably benign
R3617:Cntln	UTSW	4	85004977	nonsense	probably null
R4009:Cntln	UTSW	4	85063215	missense	probably benign	0.45
R4036:Cntln	UTSW	4	85006488	missense	probably damaging	1.00
R4548:Cntln	UTSW	4	85096842	missense	probably benign	0.27
R4592:Cntln	UTSW	4	84971182	missense	probably benign	0.00
R4666:Cntln	UTSW	4	84971216	missense	probably benign	0.13
R4826:Cntln	UTSW	4	85005044	missense	probably benign	0.03
R4836:Cntln	UTSW	4	85049720	nonsense	probably null
R4856:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R4886:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R4995:Cntln	UTSW	4	85049883	missense	probably benign	0.00
R5090:Cntln	UTSW	4	84947593	missense	probably damaging	0.98
R5202:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R5905:Cntln	UTSW	4	84971173	missense	probably benign	0.03
R5953:Cntln	UTSW	4	85049919	missense	possibly damaging	0.92
R6028:Cntln	UTSW	4	84971173	missense	probably benign	0.03
R6298:Cntln	UTSW	4	85096761	missense	probably damaging	1.00
R6351:Cntln	UTSW	4	85115354	missense	probably damaging	0.99
R6371:Cntln	UTSW	4	84884579	missense	probably damaging	0.98
R6481:Cntln	UTSW	4	85067510	missense	probably benign	0.00
R6864:Cntln	UTSW	4	85096792	missense	probably damaging	0.99
R6874:Cntln	UTSW	4	85067759	missense	probably damaging	1.00
R6919:Cntln	UTSW	4	85115368	missense	probably benign	0.04
R7071:Cntln	UTSW	4	85100385	missense	probably damaging	1.00
R7113:Cntln	UTSW	4	85049827	missense	probably damaging	0.98
R7152:Cntln	UTSW	4	84884700	missense	possibly damaging	0.87
R7253:Cntln	UTSW	4	85118473	missense	probably damaging	1.00
R7289:Cntln	UTSW	4	85046303	missense	possibly damaging	0.80
R7440:Cntln	UTSW	4	85063216	missense	possibly damaging	0.95
R7670:Cntln	UTSW	4	84979340	missense	possibly damaging	0.66
R7707:Cntln	UTSW	4	84884616	missense	probably damaging	1.00
R7895:Cntln	UTSW	4	85063324	missense	possibly damaging	0.91
R8176:Cntln	UTSW	4	84888689	missense	probably damaging	0.99
R8247:Cntln	UTSW	4	85100780	missense	probably benign	0.39
R8264:Cntln	UTSW	4	85098411	missense	probably damaging	1.00
R8293:Cntln	UTSW	4	85033838	missense	probably damaging	1.00
R8536:Cntln	UTSW	4	84957049	missense	probably damaging	1.00
R8844:Cntln	UTSW	4	84973997	missense	probably damaging	1.00
R8924:Cntln	UTSW	4	84888699	missense	probably damaging	1.00
R8955:Cntln	UTSW	4	85067873	missense	possibly damaging	0.85
R8960:Cntln	UTSW	4	85100724	missense	possibly damaging	0.59
R8979:Cntln	UTSW	4	85130673	missense	probably damaging	1.00
R9255:Cntln	UTSW	4	85100866	missense	possibly damaging	0.93
R9314:Cntln	UTSW	4	85006482	missense	probably damaging	1.00
R9353:Cntln	UTSW	4	84884360	unclassified	probably benign
R9361:Cntln	UTSW	4	85049914	missense	probably benign	0.23
R9376:Cntln	UTSW	4	84957021	missense	probably benign	0.24
R9382:Cntln	UTSW	4	85050081	missense	probably benign	0.13
R9471:Cntln	UTSW	4	85049782	missense	possibly damaging	0.62
R9478:Cntln	UTSW	4	84979393	missense	probably benign	0.00
R9527:Cntln	UTSW	4	84973883	missense	probably damaging	1.00
R9788:Cntln	UTSW	4	85049856	missense	probably damaging	1.00
R9793:Cntln	UTSW	4	85067561	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACTGTGGACATTTAAAGGAGCGGC -3'
(R):5'- ACCCTCACAGGCTCATTAGATGGAG -3'

Sequencing Primer
(F):5'- ggctgggagagtggtagag -3'
(R):5'- AGCTCAGCTACAGGCATTTC -3'

Posted On

2014-05-09