Incidental Mutation 'R1376:Galntl5'
ID186250
Institutional Source Beutler Lab
Gene Symbol Galntl5
Ensembl Gene ENSMUSG00000028938
Gene NameUDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5
Synonyms1700021B12Rik
MMRRC Submission 039440-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1376 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location25181460-25220297 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 25186288 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 62 (V62F)
Ref Sequence ENSEMBL: ENSMUSP00000030778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030778] [ENSMUST00000114965]
Predicted Effect probably benign
Transcript: ENSMUST00000030778
AA Change: V62F

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030778
Gene: ENSMUSG00000028938
AA Change: V62F

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 29 50 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 115 365 4.1e-10 PFAM
Pfam:Glycos_transf_2 118 304 4.2e-30 PFAM
Pfam:Glyco_tranf_2_2 118 383 1.7e-7 PFAM
Pfam:Glyco_transf_7C 277 349 2.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114965
AA Change: V29F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110616
Gene: ENSMUSG00000028938
AA Change: V29F

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 82 332 1.8e-10 PFAM
Pfam:Glycos_transf_2 85 271 3.3e-28 PFAM
Pfam:Glyco_tranf_2_2 85 350 8.1e-8 PFAM
Pfam:Glyco_transf_7C 244 316 2.4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158217
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 89.2%
Validation Efficiency 100% (29/29)
MGI Phenotype PHENOTYPE: Male heterozygous mice for this allele were infertile due to decreased sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik A T 11: 80,363,909 I362N possibly damaging Het
9130023H24Rik A G 7: 128,237,010 V137A probably benign Het
Adal A G 2: 121,152,530 D177G probably damaging Het
AF529169 T C 9: 89,591,246 T871A probably damaging Het
Cdcp2 G T 4: 107,102,759 V124F possibly damaging Het
Ceacam3 T C 7: 17,163,163 C685R probably damaging Het
Cep295 T C 9: 15,340,868 probably benign Het
Cfd T C 10: 79,892,152 I174T possibly damaging Het
Dapk2 C G 9: 66,220,643 R68G probably damaging Het
Ehd1 C T 19: 6,294,388 T226M probably damaging Het
Elp5 A G 11: 69,975,090 V120A probably benign Het
Fam208a A G 14: 27,429,381 K105E probably benign Het
Fzd1 G A 5: 4,757,174 T136M possibly damaging Het
Gm11787 A G 4: 3,516,373 noncoding transcript Het
Josd2 C A 7: 44,471,115 P50H probably damaging Het
Lect2 T A 13: 56,542,764 I133F probably damaging Het
Lifr A G 15: 7,184,764 T700A probably benign Het
Lpl T C 8: 68,887,598 W82R probably damaging Het
Man2a1 C T 17: 64,672,043 R523C possibly damaging Het
Mast4 T C 13: 102,736,408 K1959E possibly damaging Het
Olfr1122 A G 2: 87,387,818 M38V probably benign Het
Olfr1124 C T 2: 87,434,559 S24L possibly damaging Het
Pde4dip A G 3: 97,743,217 V963A probably damaging Het
Pdgfd A G 9: 6,376,994 I357V probably benign Het
Pold1 T C 7: 44,540,562 D400G probably damaging Het
Ppp1r12a T C 10: 108,198,918 I108T probably damaging Het
Rimbp2 G C 5: 128,770,291 P931A possibly damaging Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Homo
Sec24a A C 11: 51,700,913 probably benign Het
Sf3b1 A T 1: 55,019,265 V55E probably damaging Het
Sult2a2 T C 7: 13,734,771 V54A probably damaging Het
Taok3 T C 5: 117,265,961 Y734H probably damaging Het
Tuba3b A G 6: 145,618,774 E90G possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Other mutations in Galntl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Galntl5 APN 5 25195351 missense probably damaging 1.00
IGL01637:Galntl5 APN 5 25189825 splice site probably benign
IGL02126:Galntl5 APN 5 25189841 missense possibly damaging 0.75
IGL02136:Galntl5 APN 5 25220062 missense probably benign 0.16
IGL02836:Galntl5 APN 5 25186239 missense probably benign
R0076:Galntl5 UTSW 5 25186072 critical splice acceptor site probably null
R0411:Galntl5 UTSW 5 25220174 missense probably benign 0.20
R1376:Galntl5 UTSW 5 25186288 missense probably benign 0.16
R1686:Galntl5 UTSW 5 25210434 missense probably benign 0.16
R1724:Galntl5 UTSW 5 25220122 missense possibly damaging 0.94
R1899:Galntl5 UTSW 5 25198532 nonsense probably null
R2213:Galntl5 UTSW 5 25217529 missense probably benign 0.13
R2215:Galntl5 UTSW 5 25198478 missense probably damaging 1.00
R2425:Galntl5 UTSW 5 25220081 missense probably damaging 0.99
R3811:Galntl5 UTSW 5 25186180 missense probably benign 0.19
R3812:Galntl5 UTSW 5 25186180 missense probably benign 0.19
R4072:Galntl5 UTSW 5 25198480 nonsense probably null
R4660:Galntl5 UTSW 5 25203379 missense probably damaging 1.00
R5792:Galntl5 UTSW 5 25198463 missense possibly damaging 0.59
R5844:Galntl5 UTSW 5 25186093 intron probably benign
R6267:Galntl5 UTSW 5 25186165 missense probably benign
R6296:Galntl5 UTSW 5 25186165 missense probably benign
R6896:Galntl5 UTSW 5 25189949 critical splice donor site probably null
R7138:Galntl5 UTSW 5 25189844 missense probably benign 0.13
R7256:Galntl5 UTSW 5 25195300 missense probably benign 0.00
Z1176:Galntl5 UTSW 5 25203189 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCAAGGGGTAAGGCAAGGACTTT -3'
(R):5'- ACTGAGTTCCGGGTATCATATGTCCAT -3'

Sequencing Primer
(F):5'- GCAAGGACTTTAAATTATGCTGCC -3'
(R):5'- CCGGGTATCATATGTCCATACATGAG -3'
Posted On2014-05-09