Incidental Mutation 'R1376:9130023H24Rik'
ID186259
Institutional Source Beutler Lab
Gene Symbol 9130023H24Rik
Ensembl Gene ENSMUSG00000062944
Gene NameRIKEN cDNA 9130023H24 gene
Synonyms
MMRRC Submission 039440-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R1376 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location128234458-128238031 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128237010 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 137 (V137A)
Ref Sequence ENSEMBL: ENSMUSP00000077867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044660] [ENSMUST00000078816]
Predicted Effect probably benign
Transcript: ENSMUST00000044660
SMART Domains Protein: ENSMUSP00000040568
Gene: ENSMUSG00000042178

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 62 104 N/A INTRINSIC
ARM 137 179 2.89e-1 SMART
ARM 180 221 3.32e-1 SMART
ARM 222 263 2.93e-2 SMART
Blast:ARM 265 306 1e-8 BLAST
low complexity region 313 338 N/A INTRINSIC
ARM 353 399 4.88e0 SMART
low complexity region 418 431 N/A INTRINSIC
low complexity region 670 690 N/A INTRINSIC
Pfam:BTB 742 854 9.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078816
AA Change: V137A

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000077867
Gene: ENSMUSG00000062944
AA Change: V137A

DomainStartEndE-ValueType
ZnF_C2H2 88 110 1.89e-1 SMART
ZnF_C2H2 116 138 7.49e-5 SMART
ZnF_C2H2 144 166 1.12e-3 SMART
ZnF_C2H2 172 194 2.4e-3 SMART
ZnF_C2H2 200 222 1.95e-3 SMART
ZnF_C2H2 228 250 3.89e-3 SMART
ZnF_C2H2 256 278 1.1e-2 SMART
ZnF_C2H2 284 306 1.33e-1 SMART
ZnF_C2H2 312 334 2.53e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206509
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 89.2%
Validation Efficiency 100% (29/29)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik A T 11: 80,363,909 I362N possibly damaging Het
Adal A G 2: 121,152,530 D177G probably damaging Het
AF529169 T C 9: 89,591,246 T871A probably damaging Het
Cdcp2 G T 4: 107,102,759 V124F possibly damaging Het
Ceacam3 T C 7: 17,163,163 C685R probably damaging Het
Cep295 T C 9: 15,340,868 probably benign Het
Cfd T C 10: 79,892,152 I174T possibly damaging Het
Dapk2 C G 9: 66,220,643 R68G probably damaging Het
Ehd1 C T 19: 6,294,388 T226M probably damaging Het
Elp5 A G 11: 69,975,090 V120A probably benign Het
Fam208a A G 14: 27,429,381 K105E probably benign Het
Fzd1 G A 5: 4,757,174 T136M possibly damaging Het
Galntl5 G T 5: 25,186,288 V62F probably benign Het
Gm11787 A G 4: 3,516,373 noncoding transcript Het
Josd2 C A 7: 44,471,115 P50H probably damaging Het
Lect2 T A 13: 56,542,764 I133F probably damaging Het
Lifr A G 15: 7,184,764 T700A probably benign Het
Lpl T C 8: 68,887,598 W82R probably damaging Het
Man2a1 C T 17: 64,672,043 R523C possibly damaging Het
Mast4 T C 13: 102,736,408 K1959E possibly damaging Het
Olfr1122 A G 2: 87,387,818 M38V probably benign Het
Olfr1124 C T 2: 87,434,559 S24L possibly damaging Het
Pde4dip A G 3: 97,743,217 V963A probably damaging Het
Pdgfd A G 9: 6,376,994 I357V probably benign Het
Pold1 T C 7: 44,540,562 D400G probably damaging Het
Ppp1r12a T C 10: 108,198,918 I108T probably damaging Het
Rimbp2 G C 5: 128,770,291 P931A possibly damaging Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Homo
Sec24a A C 11: 51,700,913 probably benign Het
Sf3b1 A T 1: 55,019,265 V55E probably damaging Het
Sult2a2 T C 7: 13,734,771 V54A probably damaging Het
Taok3 T C 5: 117,265,961 Y734H probably damaging Het
Tuba3b A G 6: 145,618,774 E90G possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Other mutations in 9130023H24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:9130023H24Rik APN 7 128237119 missense probably benign 0.01
IGL01865:9130023H24Rik APN 7 128236935 missense probably damaging 1.00
R0319:9130023H24Rik UTSW 7 128237190 missense probably benign
R1376:9130023H24Rik UTSW 7 128237010 missense probably benign 0.17
R2373:9130023H24Rik UTSW 7 128237315 missense probably benign 0.13
R4751:9130023H24Rik UTSW 7 128237086 missense probably benign 0.00
R5543:9130023H24Rik UTSW 7 128237181 missense probably benign
R5577:9130023H24Rik UTSW 7 128236654 missense probably damaging 1.00
R5726:9130023H24Rik UTSW 7 128236660 missense probably damaging 1.00
R5906:9130023H24Rik UTSW 7 128236492 missense probably benign 0.01
R6800:9130023H24Rik UTSW 7 128237570 start gained probably benign
R7040:9130023H24Rik UTSW 7 128236725 missense possibly damaging 0.64
R7529:9130023H24Rik UTSW 7 128237164 nonsense probably null
R7672:9130023H24Rik UTSW 7 128237019 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTTCGCCCAAAGCTGTCTCC -3'
(R):5'- CCTTTGTCAAGACCAGTGATCCTGC -3'

Sequencing Primer
(F):5'- TTGGAGCTAACCCTGAAAGTC -3'
(R):5'- CAGTCCCCAAAGCTTTCAAG -3'
Posted On2014-05-09