Incidental Mutation 'R1376:Ppp1r12a'
ID 186266
Institutional Source Beutler Lab
Gene Symbol Ppp1r12a
Ensembl Gene ENSMUSG00000019907
Gene Name protein phosphatase 1, regulatory subunit 12A
Synonyms 1200015F06Rik, D10Ertd625e, 5730577I22Rik, Mypt1
MMRRC Submission 039440-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1376 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 107997913-108115846 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 108034779 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 108 (I108T)
Ref Sequence ENSEMBL: ENSMUSP00000151842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070663] [ENSMUST00000219263]
AlphaFold Q9DBR7
Predicted Effect probably damaging
Transcript: ENSMUST00000070663
AA Change: I108T

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000069257
Gene: ENSMUSG00000019907
AA Change: I108T

DomainStartEndE-ValueType
ANK 38 68 1.01e2 SMART
ANK 72 101 1.66e-6 SMART
ANK 105 134 6.36e-3 SMART
ANK 138 168 5.52e2 SMART
ANK 198 227 6.12e-5 SMART
ANK 231 260 5.16e-3 SMART
coiled coil region 333 354 N/A INTRINSIC
low complexity region 385 402 N/A INTRINSIC
low complexity region 469 480 N/A INTRINSIC
low complexity region 517 531 N/A INTRINSIC
low complexity region 564 578 N/A INTRINSIC
low complexity region 596 610 N/A INTRINSIC
low complexity region 626 656 N/A INTRINSIC
PDB:2KJY|A 657 712 5e-12 PDB
low complexity region 719 745 N/A INTRINSIC
low complexity region 771 794 N/A INTRINSIC
low complexity region 815 833 N/A INTRINSIC
low complexity region 836 851 N/A INTRINSIC
low complexity region 883 902 N/A INTRINSIC
Pfam:PRKG1_interact 930 993 4.5e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000219263
AA Change: I108T

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.4219 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 89.2%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosin phosphatase target subunit 1, which is also called the myosin-binding subunit of myosin phosphatase, is one of the subunits of myosin phosphatase. Myosin phosphatase regulates the interaction of actin and myosin downstream of the guanosine triphosphatase Rho. The small guanosine triphosphatase Rho is implicated in myosin light chain (MLC) phosphorylation, which results in contraction of smooth muscle and interaction of actin and myosin in nonmuscle cells. The guanosine triphosphate (GTP)-bound, active form of RhoA (GTP.RhoA) specifically interacted with the myosin-binding subunit (MBS) of myosin phosphatase, which regulates the extent of phosphorylation of MLC. Rho-associated kinase (Rho-kinase), which is activated by GTP. RhoA, phosphorylated MBS and consequently inactivated myosin phosphatase. Overexpression of RhoA or activated RhoA in NIH 3T3 cells increased phosphorylation of MBS and MLC. Thus, Rho appears to inhibit myosin phosphatase through the action of Rho-kinase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous null mice die before E7.5. Mice homozygous for a floxed allele activated in smooth muscle exhibit altered intestinal smooth muscle contractility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik A T 11: 80,254,735 (GRCm39) I362N possibly damaging Het
9130023H24Rik A G 7: 127,836,182 (GRCm39) V137A probably benign Het
Adal A G 2: 120,983,011 (GRCm39) D177G probably damaging Het
Cdcp2 G T 4: 106,959,956 (GRCm39) V124F possibly damaging Het
Ceacam3 T C 7: 16,897,088 (GRCm39) C685R probably damaging Het
Cep295 T C 9: 15,252,164 (GRCm39) probably benign Het
Cfd T C 10: 79,727,986 (GRCm39) I174T possibly damaging Het
Dapk2 C G 9: 66,127,925 (GRCm39) R68G probably damaging Het
Ehd1 C T 19: 6,344,418 (GRCm39) T226M probably damaging Het
Elp5 A G 11: 69,865,916 (GRCm39) V120A probably benign Het
Fzd1 G A 5: 4,807,174 (GRCm39) T136M possibly damaging Het
Galntl5 G T 5: 25,391,286 (GRCm39) V62F probably benign Het
Gm11787 A G 4: 3,516,373 (GRCm39) noncoding transcript Het
Josd2 C A 7: 44,120,539 (GRCm39) P50H probably damaging Het
Lect2 T A 13: 56,690,577 (GRCm39) I133F probably damaging Het
Lifr A G 15: 7,214,245 (GRCm39) T700A probably benign Het
Lpl T C 8: 69,340,250 (GRCm39) W82R probably damaging Het
Man2a1 C T 17: 64,979,038 (GRCm39) R523C possibly damaging Het
Mast4 T C 13: 102,872,916 (GRCm39) K1959E possibly damaging Het
Minar1 T C 9: 89,473,299 (GRCm39) T871A probably damaging Het
Or10ag57 A G 2: 87,218,162 (GRCm39) M38V probably benign Het
Or10ag58 C T 2: 87,264,903 (GRCm39) S24L possibly damaging Het
Pde4dip A G 3: 97,650,533 (GRCm39) V963A probably damaging Het
Pdgfd A G 9: 6,376,994 (GRCm39) I357V probably benign Het
Pold1 T C 7: 44,189,986 (GRCm39) D400G probably damaging Het
Rimbp2 G C 5: 128,847,355 (GRCm39) P931A possibly damaging Het
Rsf1 GCG GCGACG 7: 97,229,114 (GRCm39) probably benign Homo
Sec24a A C 11: 51,591,740 (GRCm39) probably benign Het
Sf3b1 A T 1: 55,058,424 (GRCm39) V55E probably damaging Het
Sult2a2 T C 7: 13,468,696 (GRCm39) V54A probably damaging Het
Taok3 T C 5: 117,404,026 (GRCm39) Y734H probably damaging Het
Tasor A G 14: 27,151,338 (GRCm39) K105E probably benign Het
Tuba3b A G 6: 145,564,500 (GRCm39) E90G possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,578,962 (GRCm39) probably benign Het
Other mutations in Ppp1r12a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Ppp1r12a APN 10 108,034,709 (GRCm39) missense probably damaging 1.00
IGL00727:Ppp1r12a APN 10 108,066,334 (GRCm39) missense probably damaging 1.00
IGL00819:Ppp1r12a APN 10 108,076,682 (GRCm39) missense probably damaging 0.98
IGL01538:Ppp1r12a APN 10 108,069,882 (GRCm39) missense probably damaging 1.00
IGL02227:Ppp1r12a APN 10 108,105,185 (GRCm39) missense probably damaging 1.00
IGL02957:Ppp1r12a APN 10 108,034,779 (GRCm39) missense probably damaging 0.98
IGL03063:Ppp1r12a APN 10 108,097,115 (GRCm39) missense probably damaging 1.00
IGL03260:Ppp1r12a APN 10 108,097,106 (GRCm39) missense probably benign 0.10
R0049:Ppp1r12a UTSW 10 108,089,193 (GRCm39) missense possibly damaging 0.63
R0268:Ppp1r12a UTSW 10 108,109,242 (GRCm39) intron probably benign
R0826:Ppp1r12a UTSW 10 108,066,414 (GRCm39) missense possibly damaging 0.46
R0839:Ppp1r12a UTSW 10 108,034,722 (GRCm39) missense probably damaging 1.00
R1026:Ppp1r12a UTSW 10 108,087,720 (GRCm39) missense probably benign 0.08
R1053:Ppp1r12a UTSW 10 108,098,212 (GRCm39) missense probably damaging 1.00
R1376:Ppp1r12a UTSW 10 108,034,779 (GRCm39) missense probably damaging 0.98
R1511:Ppp1r12a UTSW 10 108,087,720 (GRCm39) missense probably benign 0.08
R1616:Ppp1r12a UTSW 10 108,096,728 (GRCm39) missense probably damaging 1.00
R1673:Ppp1r12a UTSW 10 108,085,426 (GRCm39) missense probably damaging 0.96
R1866:Ppp1r12a UTSW 10 108,098,292 (GRCm39) missense possibly damaging 0.85
R1901:Ppp1r12a UTSW 10 108,034,752 (GRCm39) missense probably damaging 1.00
R1902:Ppp1r12a UTSW 10 108,034,752 (GRCm39) missense probably damaging 1.00
R2233:Ppp1r12a UTSW 10 108,034,780 (GRCm39) missense possibly damaging 0.83
R2234:Ppp1r12a UTSW 10 108,034,780 (GRCm39) missense possibly damaging 0.83
R3760:Ppp1r12a UTSW 10 108,100,595 (GRCm39) missense probably damaging 1.00
R3856:Ppp1r12a UTSW 10 108,089,362 (GRCm39) intron probably benign
R3973:Ppp1r12a UTSW 10 108,089,341 (GRCm39) missense probably benign 0.44
R3974:Ppp1r12a UTSW 10 108,089,341 (GRCm39) missense probably benign 0.44
R3976:Ppp1r12a UTSW 10 108,089,341 (GRCm39) missense probably benign 0.44
R4502:Ppp1r12a UTSW 10 108,085,339 (GRCm39) missense probably benign 0.26
R4902:Ppp1r12a UTSW 10 108,066,451 (GRCm39) missense probably damaging 1.00
R5092:Ppp1r12a UTSW 10 108,103,263 (GRCm39) critical splice acceptor site probably null
R5224:Ppp1r12a UTSW 10 108,096,886 (GRCm39) missense probably benign 0.37
R5353:Ppp1r12a UTSW 10 108,097,077 (GRCm39) splice site probably null
R5428:Ppp1r12a UTSW 10 108,089,208 (GRCm39) missense possibly damaging 0.76
R5472:Ppp1r12a UTSW 10 108,075,973 (GRCm39) missense probably damaging 1.00
R5510:Ppp1r12a UTSW 10 108,085,488 (GRCm39) missense possibly damaging 0.82
R6217:Ppp1r12a UTSW 10 108,076,045 (GRCm39) splice site probably null
R6274:Ppp1r12a UTSW 10 108,096,751 (GRCm39) missense probably benign 0.00
R6431:Ppp1r12a UTSW 10 108,098,281 (GRCm39) missense probably damaging 1.00
R6744:Ppp1r12a UTSW 10 108,066,395 (GRCm39) missense probably damaging 1.00
R6838:Ppp1r12a UTSW 10 108,097,137 (GRCm39) missense possibly damaging 0.76
R6865:Ppp1r12a UTSW 10 108,098,242 (GRCm39) nonsense probably null
R6993:Ppp1r12a UTSW 10 108,076,698 (GRCm39) missense probably benign 0.18
R7565:Ppp1r12a UTSW 10 108,104,501 (GRCm39) missense probably benign 0.21
R8153:Ppp1r12a UTSW 10 107,998,303 (GRCm39) missense probably damaging 0.98
R8174:Ppp1r12a UTSW 10 108,107,598 (GRCm39) missense probably benign 0.26
R8407:Ppp1r12a UTSW 10 108,076,042 (GRCm39) critical splice donor site probably null
R8422:Ppp1r12a UTSW 10 108,077,042 (GRCm39) missense probably benign
R8716:Ppp1r12a UTSW 10 108,096,749 (GRCm39) missense probably damaging 1.00
R9090:Ppp1r12a UTSW 10 108,098,224 (GRCm39) missense probably damaging 1.00
R9179:Ppp1r12a UTSW 10 108,087,782 (GRCm39) missense probably damaging 1.00
R9271:Ppp1r12a UTSW 10 108,098,224 (GRCm39) missense probably damaging 1.00
R9396:Ppp1r12a UTSW 10 108,100,571 (GRCm39) missense probably damaging 1.00
R9683:Ppp1r12a UTSW 10 108,096,747 (GRCm39) missense possibly damaging 0.78
X0027:Ppp1r12a UTSW 10 108,050,284 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTGTCTTGTTTGATGGCTGCACA -3'
(R):5'- GCCACAGCAGTGAGCAATTCAGTAT -3'

Sequencing Primer
(F):5'- GATGGCTGCACAATCATGATTG -3'
(R):5'- ttttgttttgtgacagtgtttctc -3'
Posted On 2014-05-09