Mutagenetix > Incidental Mutations

Incidental Mutation 'R1462:Pign'

186278

Institutional Source

Beutler Lab

Gene Symbol

Pign

Ensembl Gene

ENSMUSG00000056536

Gene Name

phosphatidylinositol glycan anchor biosynthesis, class N

Synonyms

MMRRC Submission

039516-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.866) question?

Stock #

R1462 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

105518422-105663677 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 105585002 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 652 (V652E)

Ref Sequence

ENSEMBL: ENSMUSP00000139638 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070699] [ENSMUST00000186485] [ENSMUST00000187537] [ENSMUST00000190811]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000070699
AA Change: V652E

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000069969
Gene: ENSMUSG00000056536
AA Change: V652E

Domain	Start	End	E-Value	Type
transmembrane domain	2	24	N/A	INTRINSIC
Pfam:Phosphodiest	116	303	1.2e-10	PFAM
Pfam:Sulfatase	148	334	2.1e-8	PFAM
low complexity region	382	393	N/A	INTRINSIC
Pfam:PigN	430	884	2.3e-138	PFAM
transmembrane domain	893	915	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000186485
AA Change: V652E

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000139638
Gene: ENSMUSG00000056536
AA Change: V652E

Domain	Start	End	E-Value	Type
transmembrane domain	2	24	N/A	INTRINSIC
Pfam:Phosphodiest	109	330	3.7e-11	PFAM
Pfam:Sulfatase	148	334	2.1e-8	PFAM
low complexity region	382	393	N/A	INTRINSIC
Pfam:PigN	430	884	1.5e-141	PFAM
transmembrane domain	893	915	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000187537
AA Change: V652E

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000140020
Gene: ENSMUSG00000056536
AA Change: V652E

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Pfam:Phosphodiest	46	331	1.2e-12	PFAM
Pfam:Sulfatase	146	334	2.9e-6	PFAM
low complexity region	382	393	N/A	INTRINSIC
Pfam:PigN	430	800	5.9e-86	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000190811
AA Change: V652E

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000140844
Gene: ENSMUSG00000056536
AA Change: V652E

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Pfam:Phosphodiest	46	331	1.1e-12	PFAM
Pfam:Sulfatase	146	334	2.8e-6	PFAM
low complexity region	382	393	N/A	INTRINSIC
Pfam:PigN	430	794	4.4e-86	PFAM

Meta Mutation Damage Score

0.4359

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.0%
20x: 92.0%

Validation Efficiency

99% (83/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This protein is expressed in the endoplasmic reticulum and transfers phosphoethanolamine (EtNP) to the first mannose of the GPI anchor. Two alternatively spliced variants, which encode an identical isoform, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit abnormal gastrulation, forebrain hypoplasia, coloboma, and microphthalmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	C	A	7: 40,992,946	S104*	probably null	Het
A430093F15Rik	A	T	19: 10,785,481		probably benign	Het
Abca13	T	A	11: 9,483,924		probably benign	Het
Abca9	T	C	11: 110,160,516	D118G	probably benign	Het
AC239677.1	T	A	5: 25,951,625	I119F	possibly damaging	Het
Adamts16	A	G	13: 70,836,134	F137L	probably benign	Het
Adamts3	T	C	5: 89,861,349	I152V	probably benign	Het
Adcy4	T	A	14: 55,778,308	E441D	possibly damaging	Het
Adgra1	T	A	7: 139,875,829	Y458N	probably damaging	Het
Atpaf1	C	T	4: 115,784,953		probably benign	Het
Bhlhe22	C	G	3: 18,055,782	S332C	probably damaging	Het
Card19	T	A	13: 49,205,284	Q71L	probably benign	Het
Ccdc12	T	C	9: 110,656,594	L11P	probably damaging	Het
Ccdc129	A	G	6: 55,975,664	H864R	probably damaging	Het
Cdadc1	A	G	14: 59,575,858	Y367H	probably damaging	Het
Cdc5l	G	T	17: 45,408,362	Q542K	possibly damaging	Het
Cep170	T	C	1: 176,756,645	K723E	possibly damaging	Het
Cep70	A	G	9: 99,263,720	I147V	probably benign	Het
Cfap58	A	T	19: 47,962,430	H410L	probably damaging	Het
Chat	T	C	14: 32,420,778	K418R	probably damaging	Het
Cic	T	G	7: 25,271,607	D254E	probably damaging	Het
Ckap4	T	C	10: 84,527,567	E544G	probably damaging	Het
Crnkl1	C	T	2: 145,921,819	A500T	probably damaging	Het
Cyp2c38	T	C	19: 39,392,188	N418D	probably damaging	Het
Daam1	A	T	12: 71,944,142	I177L	unknown	Het
Dnah1	T	C	14: 31,268,781		probably benign	Het
Ercc5	A	G	1: 44,180,624	T1019A	probably damaging	Het
F13b	T	A	1: 139,507,636	V173E	probably damaging	Het
Fam126a	A	G	5: 23,985,732		probably benign	Het
Fam135b	A	G	15: 71,621,996		probably benign	Het
Fam20a	A	C	11: 109,677,317	F316V	probably damaging	Het
Flrt2	T	C	12: 95,779,338	V150A	probably damaging	Het
Fnta	A	C	8: 25,999,571		probably null	Het
Ghsr	A	G	3: 27,371,876	D27G	probably benign	Het
Glis3	G	T	19: 28,262,518		probably benign	Het
Gm5155	T	G	7: 17,915,591		noncoding transcript	Het
Gtpbp1	A	G	15: 79,707,885	N96D	probably damaging	Het
H1fnt	A	T	15: 98,256,573	W232R	unknown	Het
Ibtk	A	T	9: 85,724,145	I443N	probably damaging	Het
Ifi207	T	C	1: 173,724,947	H968R	probably damaging	Het
Ifit2	A	G	19: 34,573,186	D42G	probably null	Het
Il17rc	A	T	6: 113,478,989	D265V	probably damaging	Het
Ints10	G	A	8: 68,807,644		probably benign	Het
Itfg2	T	C	6: 128,424,728	D29G	probably damaging	Het
Kcng3	A	T	17: 83,631,063	C186S	probably damaging	Het
Lrrc1	A	G	9: 77,442,265	F295L	probably benign	Het
Mrps28	T	A	3: 8,900,124	H85L	possibly damaging	Het
Mtpn	T	A	6: 35,522,758	K37M	possibly damaging	Het
Mug1	C	T	6: 121,882,629	H1196Y	probably benign	Het
Mup4	T	C	4: 59,960,084	H60R	possibly damaging	Het
Musk	A	G	4: 58,286,204		probably benign	Het
Mybl2	T	C	2: 163,072,708	S249P	probably benign	Het
Naip6	A	G	13: 100,300,240	Y592H	possibly damaging	Het
Nrp1	A	G	8: 128,502,798	N919S	probably benign	Het
Nudt9	C	T	5: 104,065,038	Q326*	probably null	Het
Olfr1136	A	T	2: 87,693,376	C169S	probably damaging	Het
Olfr813	A	G	10: 129,857,231	T238A	probably damaging	Het
Olfr827	T	A	10: 130,210,723	I136F	probably benign	Het
Olfr829	T	A	9: 18,857,111	M162K	probably benign	Het
Pcsk4	T	C	10: 80,325,981	E142G	probably damaging	Het
Pde3a	C	A	6: 141,459,834	P471T	probably benign	Het
Prkcb	T	A	7: 122,582,449	M420K	probably damaging	Het
Prr14	T	A	7: 127,473,988		probably null	Het
Rchy1	T	A	5: 91,957,882	Q69L	probably damaging	Het
Sccpdh	A	C	1: 179,681,560		probably benign	Het
Sec23ip	T	G	7: 128,766,138	S625A	probably benign	Het
Smpdl3b	A	G	4: 132,746,614	S47P	probably damaging	Het
Stil	G	A	4: 115,023,964	M568I	probably benign	Het
Syt3	T	A	7: 44,396,010	V558E	probably damaging	Het
Sytl3	A	G	17: 6,706,031		probably benign	Het
Szt2	A	G	4: 118,373,967	V2533A	unknown	Het
Tenm4	A	G	7: 96,704,153	Y384C	probably damaging	Het
Tfam	T	C	10: 71,235,550	E94G	probably damaging	Het
Tmbim7	A	G	5: 3,664,304	T14A	probably damaging	Het
Tmtc2	A	T	10: 105,573,705	Y15*	probably null	Het
Uhrf1	C	T	17: 56,318,035	A526V	probably damaging	Het
Vmn2r67	T	C	7: 85,155,838	D22G	probably benign	Het
Vmn2r96	A	G	17: 18,597,398	I412M	possibly damaging	Het
Vmn2r-ps69	T	A	7: 85,310,352		noncoding transcript	Het
Wdr17	A	T	8: 54,670,328	I479K	probably damaging	Het
Wt1	T	C	2: 105,166,831	V371A	probably damaging	Het
Zfp536	G	T	7: 37,479,310	S226Y	probably damaging	Het
Zfp827	T	C	8: 79,076,479	V560A	probably benign	Het

Other mutations in Pign

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Pign	APN	1	105597723	nonsense	probably null
IGL00770:Pign	APN	1	105597756	missense	probably benign	0.00
IGL00774:Pign	APN	1	105597756	missense	probably benign	0.00
IGL00828:Pign	APN	1	105554120	missense	probably damaging	0.97
IGL01407:Pign	APN	1	105589302	missense	probably benign	0.06
IGL01523:Pign	APN	1	105653178	missense	probably damaging	0.98
IGL01953:Pign	APN	1	105589039	splice site	probably benign
IGL02389:Pign	APN	1	105646781	nonsense	probably null
PIT4810001:Pign	UTSW	1	105597762	missense	possibly damaging	0.83
R0080:Pign	UTSW	1	105552405	missense	probably damaging	1.00
R0097:Pign	UTSW	1	105587976	splice site	probably benign
R0302:Pign	UTSW	1	105589093	missense	possibly damaging	0.83
R0573:Pign	UTSW	1	105653177	missense	probably damaging	1.00
R0580:Pign	UTSW	1	105591694	missense	probably benign	0.03
R0946:Pign	UTSW	1	105591697	missense	probably benign	0.00
R1397:Pign	UTSW	1	105657771	missense	probably damaging	1.00
R1462:Pign	UTSW	1	105585002	missense	possibly damaging	0.95
R1751:Pign	UTSW	1	105653192	missense	probably benign	0.19
R1753:Pign	UTSW	1	105589317	missense	possibly damaging	0.65
R1767:Pign	UTSW	1	105653192	missense	probably benign	0.19
R1854:Pign	UTSW	1	105554498	missense	probably damaging	0.99
R1907:Pign	UTSW	1	105638215	missense	possibly damaging	0.50
R2845:Pign	UTSW	1	105657796	missense	possibly damaging	0.80
R2846:Pign	UTSW	1	105657796	missense	possibly damaging	0.80
R3718:Pign	UTSW	1	105649281	critical splice donor site	probably null
R3970:Pign	UTSW	1	105656003	missense	probably damaging	1.00
R4067:Pign	UTSW	1	105587978	critical splice donor site	probably null
R4110:Pign	UTSW	1	105553815	unclassified	probably benign
R4387:Pign	UTSW	1	105522060	missense	possibly damaging	0.48
R4393:Pign	UTSW	1	105522026	missense	probably benign	0.00
R4472:Pign	UTSW	1	105648220	missense	probably benign	0.29
R4519:Pign	UTSW	1	105597666	critical splice donor site	probably null
R4619:Pign	UTSW	1	105521990	utr 3 prime	probably benign
R4746:Pign	UTSW	1	105585024	missense	probably benign	0.33
R4859:Pign	UTSW	1	105648167	nonsense	probably null
R4893:Pign	UTSW	1	105646711	missense	probably damaging	1.00
R4953:Pign	UTSW	1	105644502	missense	probably benign	0.32
R5046:Pign	UTSW	1	105522073	missense	possibly damaging	0.94
R5377:Pign	UTSW	1	105657812	missense	probably benign	0.12
R5388:Pign	UTSW	1	105655970	missense	probably damaging	1.00
R5482:Pign	UTSW	1	105546710	missense	probably benign	0.44
R5594:Pign	UTSW	1	105646869	intron	probably benign
R5639:Pign	UTSW	1	105589315	missense	probably benign	0.09
R5778:Pign	UTSW	1	105591722	missense	probably damaging	1.00
R5821:Pign	UTSW	1	105589063	missense	possibly damaging	0.95
R5928:Pign	UTSW	1	105558067	missense	possibly damaging	0.55
R5979:Pign	UTSW	1	105589274	missense	probably benign	0.01
R6213:Pign	UTSW	1	105589266	missense	possibly damaging	0.50
R6292:Pign	UTSW	1	105585077	missense	possibly damaging	0.69
R6343:Pign	UTSW	1	105585095	missense	probably benign	0.33
R6566:Pign	UTSW	1	105638181	critical splice donor site	probably null
R6856:Pign	UTSW	1	105553895	nonsense	probably null
R6954:Pign	UTSW	1	105553897	missense	probably benign	0.39
R7361:Pign	UTSW	1	105585053	missense	probably benign	0.01
R7582:Pign	UTSW	1	105649367	missense	probably benign	0.00
R7622:Pign	UTSW	1	105648117	missense	possibly damaging	0.65
R7742:Pign	UTSW	1	105552397	missense	probably benign
R7892:Pign	UTSW	1	105657676	missense	probably benign	0.01
R8273:Pign	UTSW	1	105589078	missense	probably benign	0.00
R8352:Pign	UTSW	1	105648192	missense	probably benign	0.35
R8452:Pign	UTSW	1	105648192	missense	probably benign	0.35
R8826:Pign	UTSW	1	105554102	missense	probably damaging	1.00
R8841:Pign	UTSW	1	105557909	intron	probably benign
R8886:Pign	UTSW	1	105585054	missense	probably benign
R8904:Pign	UTSW	1	105591634	missense	possibly damaging	0.87
R9074:Pign	UTSW	1	105628521	missense	unknown
R9197:Pign	UTSW	1	105589093	missense	probably benign	0.03
X0025:Pign	UTSW	1	105657634	missense	probably benign	0.03
Z1177:Pign	UTSW	1	105657820	start codon destroyed	probably null	0.98

Predicted Primers

PCR Primer
(F):5'- GGTCACCTTCACTGCGGATTTCTTG -3'
(R):5'- AACTAGCACTGCCATGTGCTTGCC -3'

Sequencing Primer
(F):5'- ACTGCGGATTTCTTGACATCAC -3'
(R):5'- AGGTCTCCATTTGAGTAAAGTGCC -3'

Posted On

2014-05-09