Incidental Mutation 'R1462:Cep170'
ID 186281
Institutional Source Beutler Lab
Gene Symbol Cep170
Ensembl Gene ENSMUSG00000057335
Gene Name centrosomal protein 170
Synonyms 4933426L22Rik, A330004A13Rik
MMRRC Submission 039516-MU
Accession Numbers

Ncbi RefSeq: NM_001099637.2; MGI:1918348

Is this an essential gene? Probably essential (E-score: 0.772) question?
Stock # R1462 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 176733653-176814067 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 176756645 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 723 (K723E)
Ref Sequence ENSEMBL: ENSMUSP00000141793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057037] [ENSMUST00000192927] [ENSMUST00000194727] [ENSMUST00000195433] [ENSMUST00000195717]
AlphaFold Q6A065
Predicted Effect probably benign
Transcript: ENSMUST00000057037
AA Change: K723E

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000059562
Gene: ENSMUSG00000057335
AA Change: K723E

DomainStartEndE-ValueType
FHA 22 73 1.27e-7 SMART
low complexity region 118 133 N/A INTRINSIC
low complexity region 717 731 N/A INTRINSIC
low complexity region 738 750 N/A INTRINSIC
low complexity region 770 782 N/A INTRINSIC
Pfam:CEP170_C 801 1496 3.3e-264 PFAM
low complexity region 1533 1545 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192664
Predicted Effect probably benign
Transcript: ENSMUST00000192927
SMART Domains Protein: ENSMUSP00000142032
Gene: ENSMUSG00000057335

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Pfam:CEP170_C 30 469 3.4e-129 PFAM
Pfam:CEP170_C 449 708 7.4e-102 PFAM
low complexity region 742 754 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000194727
AA Change: K723E

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141793
Gene: ENSMUSG00000057335
AA Change: K723E

DomainStartEndE-ValueType
FHA 22 73 1.27e-7 SMART
low complexity region 118 133 N/A INTRINSIC
low complexity region 717 731 N/A INTRINSIC
low complexity region 738 750 N/A INTRINSIC
low complexity region 770 782 N/A INTRINSIC
Pfam:CEP170_C 795 1509 8e-260 PFAM
low complexity region 1543 1555 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195121
Predicted Effect probably benign
Transcript: ENSMUST00000195433
SMART Domains Protein: ENSMUSP00000142108
Gene: ENSMUSG00000057335

DomainStartEndE-ValueType
FHA 22 73 6.1e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195463
Predicted Effect probably benign
Transcript: ENSMUST00000195717
AA Change: K723E

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000141769
Gene: ENSMUSG00000057335
AA Change: K723E

DomainStartEndE-ValueType
FHA 22 73 1.27e-7 SMART
low complexity region 118 133 N/A INTRINSIC
low complexity region 717 731 N/A INTRINSIC
low complexity region 738 750 N/A INTRINSIC
low complexity region 770 782 N/A INTRINSIC
Pfam:CEP170_C 795 1499 1.8e-261 PFAM
low complexity region 1533 1545 N/A INTRINSIC
Meta Mutation Damage Score 0.0756 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a component of the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. During interphase, the encoded protein localizes to the sub-distal appendages of mature centrioles, which are microtubule-based structures thought to help organize centrosomes. During mitosis, the protein associates with spindle microtubules near the centrosomes. The protein interacts with and is phosphorylated by polo-like kinase 1, and functions in maintaining microtubule organization and cell morphology. The human genome contains a putative transcribed pseudogene. Several alternatively spliced transcript variants of this gene have been found, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(29) : Gene trapped(29)

Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C A 7: 40,992,946 S104* probably null Het
A430093F15Rik A T 19: 10,785,481 probably benign Het
Abca13 T A 11: 9,483,924 probably benign Het
Abca9 T C 11: 110,160,516 D118G probably benign Het
AC239677.1 T A 5: 25,951,625 I119F possibly damaging Het
Adamts16 A G 13: 70,836,134 F137L probably benign Het
Adamts3 T C 5: 89,861,349 I152V probably benign Het
Adcy4 T A 14: 55,778,308 E441D possibly damaging Het
Adgra1 T A 7: 139,875,829 Y458N probably damaging Het
Atpaf1 C T 4: 115,784,953 probably benign Het
Bhlhe22 C G 3: 18,055,782 S332C probably damaging Het
Card19 T A 13: 49,205,284 Q71L probably benign Het
Ccdc12 T C 9: 110,656,594 L11P probably damaging Het
Ccdc129 A G 6: 55,975,664 H864R probably damaging Het
Cdadc1 A G 14: 59,575,858 Y367H probably damaging Het
Cdc5l G T 17: 45,408,362 Q542K possibly damaging Het
Cep70 A G 9: 99,263,720 I147V probably benign Het
Cfap58 A T 19: 47,962,430 H410L probably damaging Het
Chat T C 14: 32,420,778 K418R probably damaging Het
Cic T G 7: 25,271,607 D254E probably damaging Het
Ckap4 T C 10: 84,527,567 E544G probably damaging Het
Crnkl1 C T 2: 145,921,819 A500T probably damaging Het
Cyp2c38 T C 19: 39,392,188 N418D probably damaging Het
Daam1 A T 12: 71,944,142 I177L unknown Het
Dnah1 T C 14: 31,268,781 probably benign Het
Ercc5 A G 1: 44,180,624 T1019A probably damaging Het
F13b T A 1: 139,507,636 V173E probably damaging Het
Fam126a A G 5: 23,985,732 probably benign Het
Fam135b A G 15: 71,621,996 probably benign Het
Fam20a A C 11: 109,677,317 F316V probably damaging Het
Flrt2 T C 12: 95,779,338 V150A probably damaging Het
Fnta A C 8: 25,999,571 probably null Het
Ghsr A G 3: 27,371,876 D27G probably benign Het
Glis3 G T 19: 28,262,518 probably benign Het
Gm5155 T G 7: 17,915,591 noncoding transcript Het
Gtpbp1 A G 15: 79,707,885 N96D probably damaging Het
H1fnt A T 15: 98,256,573 W232R unknown Het
Ibtk A T 9: 85,724,145 I443N probably damaging Het
Ifi207 T C 1: 173,724,947 H968R probably damaging Het
Ifit2 A G 19: 34,573,186 D42G probably null Het
Il17rc A T 6: 113,478,989 D265V probably damaging Het
Ints10 G A 8: 68,807,644 probably benign Het
Itfg2 T C 6: 128,424,728 D29G probably damaging Het
Kcng3 A T 17: 83,631,063 C186S probably damaging Het
Lrrc1 A G 9: 77,442,265 F295L probably benign Het
Mrps28 T A 3: 8,900,124 H85L possibly damaging Het
Mtpn T A 6: 35,522,758 K37M possibly damaging Het
Mug1 C T 6: 121,882,629 H1196Y probably benign Het
Mup4 T C 4: 59,960,084 H60R possibly damaging Het
Musk A G 4: 58,286,204 probably benign Het
Mybl2 T C 2: 163,072,708 S249P probably benign Het
Naip6 A G 13: 100,300,240 Y592H possibly damaging Het
Nrp1 A G 8: 128,502,798 N919S probably benign Het
Nudt9 C T 5: 104,065,038 Q326* probably null Het
Olfr1136 A T 2: 87,693,376 C169S probably damaging Het
Olfr813 A G 10: 129,857,231 T238A probably damaging Het
Olfr827 T A 10: 130,210,723 I136F probably benign Het
Olfr829 T A 9: 18,857,111 M162K probably benign Het
Pcsk4 T C 10: 80,325,981 E142G probably damaging Het
Pde3a C A 6: 141,459,834 P471T probably benign Het
Pign A T 1: 105,585,002 V652E possibly damaging Het
Prkcb T A 7: 122,582,449 M420K probably damaging Het
Prr14 T A 7: 127,473,988 probably null Het
Rchy1 T A 5: 91,957,882 Q69L probably damaging Het
Sccpdh A C 1: 179,681,560 probably benign Het
Sec23ip T G 7: 128,766,138 S625A probably benign Het
Smpdl3b A G 4: 132,746,614 S47P probably damaging Het
Stil G A 4: 115,023,964 M568I probably benign Het
Syt3 T A 7: 44,396,010 V558E probably damaging Het
Sytl3 A G 17: 6,706,031 probably benign Het
Szt2 A G 4: 118,373,967 V2533A unknown Het
Tenm4 A G 7: 96,704,153 Y384C probably damaging Het
Tfam T C 10: 71,235,550 E94G probably damaging Het
Tmbim7 A G 5: 3,664,304 T14A probably damaging Het
Tmtc2 A T 10: 105,573,705 Y15* probably null Het
Uhrf1 C T 17: 56,318,035 A526V probably damaging Het
Vmn2r67 T C 7: 85,155,838 D22G probably benign Het
Vmn2r96 A G 17: 18,597,398 I412M possibly damaging Het
Vmn2r-ps69 T A 7: 85,310,352 noncoding transcript Het
Wdr17 A T 8: 54,670,328 I479K probably damaging Het
Wt1 T C 2: 105,166,831 V371A probably damaging Het
Zfp536 G T 7: 37,479,310 S226Y probably damaging Het
Zfp827 T C 8: 79,076,479 V560A probably benign Het
Other mutations in Cep170
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Cep170 APN 1 176755399 missense probably damaging 1.00
IGL00925:Cep170 APN 1 176793524 missense probably damaging 1.00
IGL00972:Cep170 APN 1 176735696 missense probably benign 0.00
IGL01488:Cep170 APN 1 176756375 missense probably benign 0.00
IGL01916:Cep170 APN 1 176739910 splice site probably benign
IGL02212:Cep170 APN 1 176735936 missense probably damaging 0.99
IGL02269:Cep170 APN 1 176769366 missense probably benign
IGL02732:Cep170 APN 1 176736874 missense probably damaging 1.00
IGL02740:Cep170 APN 1 176793600 missense probably damaging 1.00
IGL02812:Cep170 APN 1 176742514 missense probably damaging 1.00
IGL03036:Cep170 APN 1 176769337 missense possibly damaging 0.87
IGL03201:Cep170 APN 1 176736888 missense probably damaging 1.00
IGL03333:Cep170 APN 1 176769526 missense possibly damaging 0.64
BB003:Cep170 UTSW 1 176761413 missense probably damaging 0.97
BB013:Cep170 UTSW 1 176761413 missense probably damaging 0.97
PIT4520001:Cep170 UTSW 1 176780199 missense unknown
R0031:Cep170 UTSW 1 176756091 missense probably damaging 1.00
R0039:Cep170 UTSW 1 176782495 critical splice donor site probably null
R0053:Cep170 UTSW 1 176782380 missense possibly damaging 0.82
R0053:Cep170 UTSW 1 176782380 missense possibly damaging 0.82
R0113:Cep170 UTSW 1 176758455 missense probably damaging 0.97
R0144:Cep170 UTSW 1 176792595 missense probably benign 0.01
R0613:Cep170 UTSW 1 176774680 missense probably benign
R0755:Cep170 UTSW 1 176755753 missense probably damaging 1.00
R1132:Cep170 UTSW 1 176750037 missense probably damaging 1.00
R1367:Cep170 UTSW 1 176735724 missense probably damaging 0.99
R1399:Cep170 UTSW 1 176758403 missense probably damaging 0.98
R1462:Cep170 UTSW 1 176756645 missense possibly damaging 0.46
R1481:Cep170 UTSW 1 176782385 missense possibly damaging 0.56
R1526:Cep170 UTSW 1 176788505 missense probably damaging 1.00
R1540:Cep170 UTSW 1 176739932 missense probably damaging 1.00
R1552:Cep170 UTSW 1 176782494 splice site probably benign
R1570:Cep170 UTSW 1 176755801 missense possibly damaging 0.64
R1846:Cep170 UTSW 1 176755769 missense probably damaging 1.00
R1884:Cep170 UTSW 1 176774679 missense probably benign 0.12
R1945:Cep170 UTSW 1 176793534 nonsense probably null
R1954:Cep170 UTSW 1 176756384 missense probably benign
R1957:Cep170 UTSW 1 176769447 missense probably benign 0.24
R2184:Cep170 UTSW 1 176756976 missense probably benign 0.00
R2280:Cep170 UTSW 1 176774505 missense probably benign 0.17
R2426:Cep170 UTSW 1 176774635 missense probably benign
R3415:Cep170 UTSW 1 176756044 missense probably damaging 1.00
R3417:Cep170 UTSW 1 176756044 missense probably damaging 1.00
R3752:Cep170 UTSW 1 176782495 critical splice donor site probably benign
R3848:Cep170 UTSW 1 176755843 missense probably benign 0.14
R3849:Cep170 UTSW 1 176755843 missense probably benign 0.14
R4752:Cep170 UTSW 1 176756688 missense probably benign 0.00
R4910:Cep170 UTSW 1 176782263 missense possibly damaging 0.94
R5007:Cep170 UTSW 1 176769814 missense probably benign 0.28
R5052:Cep170 UTSW 1 176793551 missense probably damaging 1.00
R5093:Cep170 UTSW 1 176769330 missense possibly damaging 0.95
R5530:Cep170 UTSW 1 176769510 missense probably benign 0.00
R5622:Cep170 UTSW 1 176735867 missense possibly damaging 0.64
R5892:Cep170 UTSW 1 176755387 splice site probably null
R5942:Cep170 UTSW 1 176756419 missense probably damaging 1.00
R6083:Cep170 UTSW 1 176774625 missense probably damaging 1.00
R6091:Cep170 UTSW 1 176755831 missense probably damaging 0.98
R6190:Cep170 UTSW 1 176782409 missense probably damaging 1.00
R6253:Cep170 UTSW 1 176780394 missense possibly damaging 0.71
R6476:Cep170 UTSW 1 176780351 missense possibly damaging 0.72
R6622:Cep170 UTSW 1 176756332 missense probably damaging 1.00
R6932:Cep170 UTSW 1 176761437 missense possibly damaging 0.90
R7030:Cep170 UTSW 1 176756485 missense probably damaging 0.99
R7163:Cep170 UTSW 1 176774465 missense probably damaging 1.00
R7352:Cep170 UTSW 1 176769857 missense probably benign 0.11
R7499:Cep170 UTSW 1 176774462 missense probably damaging 1.00
R7502:Cep170 UTSW 1 176756029 missense probably damaging 1.00
R7773:Cep170 UTSW 1 176740076 missense
R7926:Cep170 UTSW 1 176761413 missense probably damaging 0.97
R8043:Cep170 UTSW 1 176769242 missense probably damaging 0.96
R8203:Cep170 UTSW 1 176769311 missense probably benign 0.28
R8350:Cep170 UTSW 1 176736879 missense
R8450:Cep170 UTSW 1 176736879 missense
R8835:Cep170 UTSW 1 176756863 missense probably benign 0.00
R8931:Cep170 UTSW 1 176769811 missense probably benign 0.02
R9108:Cep170 UTSW 1 176788485 nonsense probably null
R9323:Cep170 UTSW 1 176758502 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCGCACTAACGATTTGGAAGACTC -3'
(R):5'- TCGTTCCACAGAGGTCAGAGATAGG -3'

Sequencing Primer
(F):5'- GCTCGTAGAATGTCCTGAAAC -3'
(R):5'- TCAGAGATAGGAGAAAAGCAAGACAC -3'
Posted On 2014-05-09