Mutagenetix > Incidental Mutations

Incidental Mutation 'R1462:Bhlhe22'

186288

Institutional Source

Beutler Lab

Gene Symbol

Bhlhe22

Ensembl Gene

ENSMUSG00000025128

Gene Name

basic helix-loop-helix family, member e22

Synonyms

Beta3, Bhlhb5

MMRRC Submission

039516-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1462 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

18054174-18057517 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 18055782 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Cysteine at position 332 (S332C)

Ref Sequence

ENSEMBL: ENSMUSP00000026120 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026120]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000026120
AA Change: S332C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000026120
Gene: ENSMUSG00000025128
AA Change: S332C

Domain	Start	End	E-Value	Type
low complexity region	71	106	N/A	INTRINSIC
low complexity region	155	172	N/A	INTRINSIC
low complexity region	185	212	N/A	INTRINSIC
HLH	222	276	2.72e-16	SMART
low complexity region	289	314	N/A	INTRINSIC

Meta Mutation Damage Score

0.0896

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.0%
20x: 92.0%

Validation Efficiency

99% (83/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the basic helix-loop-helix (bHLH) family of transcription factors that regulate cell fate determination, proliferation, and differentiation. A similar protein in mouse is required for the development of the dorsal cochlear nuclei, and is thought to play a role in in the differentiation of neurons involved in sensory input. The mouse protein also functions in retinogenesis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a null mutation are slow to gain weight, develop skin lesions, have reduced numbers of specific subtypes of amacrine and cone bipolar cells, and exhibit abnormal innervation of the corticospinal tract. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	C	A	7: 40,992,946	S104*	probably null	Het
A430093F15Rik	A	T	19: 10,785,481		probably benign	Het
Abca13	T	A	11: 9,483,924		probably benign	Het
Abca9	T	C	11: 110,160,516	D118G	probably benign	Het
AC239677.1	T	A	5: 25,951,625	I119F	possibly damaging	Het
Adamts16	A	G	13: 70,836,134	F137L	probably benign	Het
Adamts3	T	C	5: 89,861,349	I152V	probably benign	Het
Adcy4	T	A	14: 55,778,308	E441D	possibly damaging	Het
Adgra1	T	A	7: 139,875,829	Y458N	probably damaging	Het
Atpaf1	C	T	4: 115,784,953		probably benign	Het
Card19	T	A	13: 49,205,284	Q71L	probably benign	Het
Ccdc12	T	C	9: 110,656,594	L11P	probably damaging	Het
Ccdc129	A	G	6: 55,975,664	H864R	probably damaging	Het
Cdadc1	A	G	14: 59,575,858	Y367H	probably damaging	Het
Cdc5l	G	T	17: 45,408,362	Q542K	possibly damaging	Het
Cep170	T	C	1: 176,756,645	K723E	possibly damaging	Het
Cep70	A	G	9: 99,263,720	I147V	probably benign	Het
Cfap58	A	T	19: 47,962,430	H410L	probably damaging	Het
Chat	T	C	14: 32,420,778	K418R	probably damaging	Het
Cic	T	G	7: 25,271,607	D254E	probably damaging	Het
Ckap4	T	C	10: 84,527,567	E544G	probably damaging	Het
Crnkl1	C	T	2: 145,921,819	A500T	probably damaging	Het
Cyp2c38	T	C	19: 39,392,188	N418D	probably damaging	Het
Daam1	A	T	12: 71,944,142	I177L	unknown	Het
Dnah1	T	C	14: 31,268,781		probably benign	Het
Ercc5	A	G	1: 44,180,624	T1019A	probably damaging	Het
F13b	T	A	1: 139,507,636	V173E	probably damaging	Het
Fam126a	A	G	5: 23,985,732		probably benign	Het
Fam135b	A	G	15: 71,621,996		probably benign	Het
Fam20a	A	C	11: 109,677,317	F316V	probably damaging	Het
Flrt2	T	C	12: 95,779,338	V150A	probably damaging	Het
Fnta	A	C	8: 25,999,571		probably null	Het
Ghsr	A	G	3: 27,371,876	D27G	probably benign	Het
Glis3	G	T	19: 28,262,518		probably benign	Het
Gm5155	T	G	7: 17,915,591		noncoding transcript	Het
Gtpbp1	A	G	15: 79,707,885	N96D	probably damaging	Het
H1fnt	A	T	15: 98,256,573	W232R	unknown	Het
Ibtk	A	T	9: 85,724,145	I443N	probably damaging	Het
Ifi207	T	C	1: 173,724,947	H968R	probably damaging	Het
Ifit2	A	G	19: 34,573,186	D42G	probably null	Het
Il17rc	A	T	6: 113,478,989	D265V	probably damaging	Het
Ints10	G	A	8: 68,807,644		probably benign	Het
Itfg2	T	C	6: 128,424,728	D29G	probably damaging	Het
Kcng3	A	T	17: 83,631,063	C186S	probably damaging	Het
Lrrc1	A	G	9: 77,442,265	F295L	probably benign	Het
Mrps28	T	A	3: 8,900,124	H85L	possibly damaging	Het
Mtpn	T	A	6: 35,522,758	K37M	possibly damaging	Het
Mug1	C	T	6: 121,882,629	H1196Y	probably benign	Het
Mup4	T	C	4: 59,960,084	H60R	possibly damaging	Het
Musk	A	G	4: 58,286,204		probably benign	Het
Mybl2	T	C	2: 163,072,708	S249P	probably benign	Het
Naip6	A	G	13: 100,300,240	Y592H	possibly damaging	Het
Nrp1	A	G	8: 128,502,798	N919S	probably benign	Het
Nudt9	C	T	5: 104,065,038	Q326*	probably null	Het
Olfr1136	A	T	2: 87,693,376	C169S	probably damaging	Het
Olfr813	A	G	10: 129,857,231	T238A	probably damaging	Het
Olfr827	T	A	10: 130,210,723	I136F	probably benign	Het
Olfr829	T	A	9: 18,857,111	M162K	probably benign	Het
Pcsk4	T	C	10: 80,325,981	E142G	probably damaging	Het
Pde3a	C	A	6: 141,459,834	P471T	probably benign	Het
Pign	A	T	1: 105,585,002	V652E	possibly damaging	Het
Prkcb	T	A	7: 122,582,449	M420K	probably damaging	Het
Prr14	T	A	7: 127,473,988		probably null	Het
Rchy1	T	A	5: 91,957,882	Q69L	probably damaging	Het
Sccpdh	A	C	1: 179,681,560		probably benign	Het
Sec23ip	T	G	7: 128,766,138	S625A	probably benign	Het
Smpdl3b	A	G	4: 132,746,614	S47P	probably damaging	Het
Stil	G	A	4: 115,023,964	M568I	probably benign	Het
Syt3	T	A	7: 44,396,010	V558E	probably damaging	Het
Sytl3	A	G	17: 6,706,031		probably benign	Het
Szt2	A	G	4: 118,373,967	V2533A	unknown	Het
Tenm4	A	G	7: 96,704,153	Y384C	probably damaging	Het
Tfam	T	C	10: 71,235,550	E94G	probably damaging	Het
Tmbim7	A	G	5: 3,664,304	T14A	probably damaging	Het
Tmtc2	A	T	10: 105,573,705	Y15*	probably null	Het
Uhrf1	C	T	17: 56,318,035	A526V	probably damaging	Het
Vmn2r67	T	C	7: 85,155,838	D22G	probably benign	Het
Vmn2r96	A	G	17: 18,597,398	I412M	possibly damaging	Het
Vmn2r-ps69	T	A	7: 85,310,352		noncoding transcript	Het
Wdr17	A	T	8: 54,670,328	I479K	probably damaging	Het
Wt1	T	C	2: 105,166,831	V371A	probably damaging	Het
Zfp536	G	T	7: 37,479,310	S226Y	probably damaging	Het
Zfp827	T	C	8: 79,076,479	V560A	probably benign	Het

Other mutations in Bhlhe22

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01946:Bhlhe22	APN	3	18055796	missense	probably damaging	1.00
IGL02615:Bhlhe22	APN	3	18054900	missense	possibly damaging	0.75
butchered	UTSW	3	18055569	missense	probably damaging	1.00
R0047:Bhlhe22	UTSW	3	18055569	missense	probably damaging	1.00
R1462:Bhlhe22	UTSW	3	18055782	missense	probably damaging	1.00
R1832:Bhlhe22	UTSW	3	18054975	missense	probably damaging	0.99
R2025:Bhlhe22	UTSW	3	18055811	missense	probably benign	0.02
R2400:Bhlhe22	UTSW	3	18055451	missense	probably damaging	0.99
R3981:Bhlhe22	UTSW	3	18054894	missense	probably damaging	0.96
R4505:Bhlhe22	UTSW	3	18054959	missense	probably benign
R4507:Bhlhe22	UTSW	3	18054959	missense	probably benign
R6128:Bhlhe22	UTSW	3	18055823	missense	probably damaging	1.00
R6317:Bhlhe22	UTSW	3	18055614	missense	probably damaging	1.00
R7199:Bhlhe22	UTSW	3	18055842	missense	probably damaging	1.00
R9124:Bhlhe22	UTSW	3	18055178	missense	probably damaging	0.99
R9214:Bhlhe22	UTSW	3	18054860	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCAGTGCGGAAGCTCTCCAAAATC -3'
(R):5'- GCCCTGCAAGTGTTTCACAACTTAG -3'

Sequencing Primer
(F):5'- ATCCTCATGCAGGCACAGG -3'
(R):5'- TGTTTCACAACTTAGGAGAGGACC -3'

Posted On

2014-05-09