Incidental Mutation 'R1462:Pde3a'
ID 186306
Institutional Source Beutler Lab
Gene Symbol Pde3a
Ensembl Gene ENSMUSG00000041741
Gene Name phosphodiesterase 3A, cGMP inhibited
Synonyms A930022O17Rik
MMRRC Submission 039516-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.272) question?
Stock # R1462 (G1)
Quality Score 161
Status Validated
Chromosome 6
Chromosomal Location 141194995-141452588 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 141405560 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Threonine at position 471 (P471T)
Ref Sequence ENSEMBL: ENSMUSP00000038749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043259]
AlphaFold Q9Z0X4
Predicted Effect probably benign
Transcript: ENSMUST00000043259
AA Change: P471T

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000038749
Gene: ENSMUSG00000041741
AA Change: P471T

DomainStartEndE-ValueType
low complexity region 29 43 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
low complexity region 103 121 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
transmembrane domain 230 252 N/A INTRINSIC
low complexity region 419 445 N/A INTRINSIC
low complexity region 520 544 N/A INTRINSIC
HDc 749 964 3.76e-4 SMART
low complexity region 1028 1056 N/A INTRINSIC
low complexity region 1114 1133 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189060
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cGMP-inhibited cyclic nucleotide phosphodiesterase (cGI-PDE) family. cGI-PDE enzymes hydrolyze both cAMP and cGMP, and play critical roles in many cellular processes by regulating the amplitude and duration of intracellular cyclic nucleotide signals. The encoded protein mediates platelet aggregation and also plays important roles in cardiovascular function by regulating vascular smooth muscle contraction and relaxation. Inhibitors of the encoded protein may be effective in treating congestive heart failure. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice display female infertility with oocyte arrest. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C A 7: 40,642,370 (GRCm39) S104* probably null Het
A430093F15Rik A T 19: 10,762,845 (GRCm39) probably benign Het
Abca13 T A 11: 9,433,924 (GRCm39) probably benign Het
Abca9 T C 11: 110,051,342 (GRCm39) D118G probably benign Het
Adamts16 A G 13: 70,984,253 (GRCm39) F137L probably benign Het
Adamts3 T C 5: 90,009,208 (GRCm39) I152V probably benign Het
Adcy4 T A 14: 56,015,765 (GRCm39) E441D possibly damaging Het
Adgra1 T A 7: 139,455,745 (GRCm39) Y458N probably damaging Het
Atpaf1 C T 4: 115,642,150 (GRCm39) probably benign Het
Bhlhe22 C G 3: 18,109,946 (GRCm39) S332C probably damaging Het
Card19 T A 13: 49,358,760 (GRCm39) Q71L probably benign Het
Ccdc12 T C 9: 110,485,662 (GRCm39) L11P probably damaging Het
Cdadc1 A G 14: 59,813,307 (GRCm39) Y367H probably damaging Het
Cdc5l G T 17: 45,719,288 (GRCm39) Q542K possibly damaging Het
Ceacam23 T G 7: 17,649,516 (GRCm39) noncoding transcript Het
Cep170 T C 1: 176,584,211 (GRCm39) K723E possibly damaging Het
Cep70 A G 9: 99,145,773 (GRCm39) I147V probably benign Het
Cfap58 A T 19: 47,950,869 (GRCm39) H410L probably damaging Het
Chat T C 14: 32,142,735 (GRCm39) K418R probably damaging Het
Cic T G 7: 24,971,032 (GRCm39) D254E probably damaging Het
Ckap4 T C 10: 84,363,431 (GRCm39) E544G probably damaging Het
Crnkl1 C T 2: 145,763,739 (GRCm39) A500T probably damaging Het
Cyp2c38 T C 19: 39,380,632 (GRCm39) N418D probably damaging Het
Daam1 A T 12: 71,990,916 (GRCm39) I177L unknown Het
Dnah1 T C 14: 30,990,738 (GRCm39) probably benign Het
Ercc5 A G 1: 44,219,784 (GRCm39) T1019A probably damaging Het
F13b T A 1: 139,435,374 (GRCm39) V173E probably damaging Het
Fam135b A G 15: 71,493,845 (GRCm39) probably benign Het
Fam20a A C 11: 109,568,143 (GRCm39) F316V probably damaging Het
Flrt2 T C 12: 95,746,112 (GRCm39) V150A probably damaging Het
Fnta A C 8: 26,489,599 (GRCm39) probably null Het
Ghsr A G 3: 27,426,025 (GRCm39) D27G probably benign Het
Glis3 G T 19: 28,239,918 (GRCm39) probably benign Het
Gtpbp1 A G 15: 79,592,086 (GRCm39) N96D probably damaging Het
H1f7 A T 15: 98,154,454 (GRCm39) W232R unknown Het
Hycc1 A G 5: 24,190,730 (GRCm39) probably benign Het
Ibtk A T 9: 85,606,198 (GRCm39) I443N probably damaging Het
Ifi207 T C 1: 173,552,513 (GRCm39) H968R probably damaging Het
Ifit2 A G 19: 34,550,586 (GRCm39) D42G probably null Het
Il17rc A T 6: 113,455,950 (GRCm39) D265V probably damaging Het
Ints10 G A 8: 69,260,296 (GRCm39) probably benign Het
Itfg2 T C 6: 128,401,691 (GRCm39) D29G probably damaging Het
Itprid1 A G 6: 55,952,649 (GRCm39) H864R probably damaging Het
Kcng3 A T 17: 83,938,492 (GRCm39) C186S probably damaging Het
Lrrc1 A G 9: 77,349,547 (GRCm39) F295L probably benign Het
Mrps28 T A 3: 8,965,184 (GRCm39) H85L possibly damaging Het
Mtpn T A 6: 35,499,693 (GRCm39) K37M possibly damaging Het
Mug1 C T 6: 121,859,588 (GRCm39) H1196Y probably benign Het
Mup4 T C 4: 59,960,084 (GRCm39) H60R possibly damaging Het
Musk A G 4: 58,286,204 (GRCm39) probably benign Het
Mybl2 T C 2: 162,914,628 (GRCm39) S249P probably benign Het
Naip6 A G 13: 100,436,748 (GRCm39) Y592H possibly damaging Het
Nrp1 A G 8: 129,229,279 (GRCm39) N919S probably benign Het
Nudt9 C T 5: 104,212,904 (GRCm39) Q326* probably null Het
Or5w13 A T 2: 87,523,720 (GRCm39) C169S probably damaging Het
Or6c76b A G 10: 129,693,100 (GRCm39) T238A probably damaging Het
Or7g17 T A 9: 18,768,407 (GRCm39) M162K probably benign Het
Or9k7 T A 10: 130,046,592 (GRCm39) I136F probably benign Het
Pcsk4 T C 10: 80,161,815 (GRCm39) E142G probably damaging Het
Pign A T 1: 105,512,727 (GRCm39) V652E possibly damaging Het
Prkcb T A 7: 122,181,672 (GRCm39) M420K probably damaging Het
Prr14 T A 7: 127,073,160 (GRCm39) probably null Het
Rchy1 T A 5: 92,105,741 (GRCm39) Q69L probably damaging Het
Sccpdh A C 1: 179,509,125 (GRCm39) probably benign Het
Sec23ip T G 7: 128,367,862 (GRCm39) S625A probably benign Het
Smpdl3b A G 4: 132,473,925 (GRCm39) S47P probably damaging Het
Speer4a3 T A 5: 26,156,623 (GRCm39) I119F possibly damaging Het
Stil G A 4: 114,881,161 (GRCm39) M568I probably benign Het
Syt3 T A 7: 44,045,434 (GRCm39) V558E probably damaging Het
Sytl3 A G 17: 6,973,430 (GRCm39) probably benign Het
Szt2 A G 4: 118,231,164 (GRCm39) V2533A unknown Het
Tenm4 A G 7: 96,353,360 (GRCm39) Y384C probably damaging Het
Tfam T C 10: 71,071,380 (GRCm39) E94G probably damaging Het
Tmbim7 A G 5: 3,714,304 (GRCm39) T14A probably damaging Het
Tmtc2 A T 10: 105,409,566 (GRCm39) Y15* probably null Het
Uhrf1 C T 17: 56,625,035 (GRCm39) A526V probably damaging Het
Vmn2r67 T C 7: 84,805,046 (GRCm39) D22G probably benign Het
Vmn2r96 A G 17: 18,817,660 (GRCm39) I412M possibly damaging Het
Vmn2r-ps69 T A 7: 84,959,560 (GRCm39) noncoding transcript Het
Wdr17 A T 8: 55,123,363 (GRCm39) I479K probably damaging Het
Wt1 T C 2: 104,997,176 (GRCm39) V371A probably damaging Het
Zfp536 G T 7: 37,178,735 (GRCm39) S226Y probably damaging Het
Zfp827 T C 8: 79,803,108 (GRCm39) V560A probably benign Het
Other mutations in Pde3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Pde3a APN 6 141,405,464 (GRCm39) missense probably damaging 1.00
IGL01400:Pde3a APN 6 141,404,954 (GRCm39) missense probably benign 0.02
IGL01752:Pde3a APN 6 141,433,339 (GRCm39) splice site probably benign
IGL01819:Pde3a APN 6 141,433,263 (GRCm39) missense probably damaging 1.00
IGL02014:Pde3a APN 6 141,404,870 (GRCm39) missense probably null 1.00
IGL02119:Pde3a APN 6 141,405,529 (GRCm39) missense probably damaging 0.97
IGL02465:Pde3a APN 6 141,195,401 (GRCm39) missense possibly damaging 0.53
IGL02677:Pde3a APN 6 141,350,898 (GRCm39) splice site probably benign
IGL02961:Pde3a APN 6 141,405,426 (GRCm39) nonsense probably null
IGL03034:Pde3a APN 6 141,438,126 (GRCm39) splice site probably benign
IGL03142:Pde3a APN 6 141,438,025 (GRCm39) missense probably benign 0.01
PIT4305001:Pde3a UTSW 6 141,438,036 (GRCm39) missense probably benign 0.04
R0412:Pde3a UTSW 6 141,444,410 (GRCm39) missense probably damaging 1.00
R0517:Pde3a UTSW 6 141,444,383 (GRCm39) nonsense probably null
R0573:Pde3a UTSW 6 141,437,957 (GRCm39) missense probably damaging 1.00
R0621:Pde3a UTSW 6 141,195,725 (GRCm39) missense probably damaging 1.00
R0781:Pde3a UTSW 6 141,405,042 (GRCm39) splice site probably benign
R1065:Pde3a UTSW 6 141,422,458 (GRCm39) splice site probably benign
R1110:Pde3a UTSW 6 141,405,042 (GRCm39) splice site probably benign
R1462:Pde3a UTSW 6 141,405,560 (GRCm39) missense probably benign 0.05
R1470:Pde3a UTSW 6 141,411,932 (GRCm39) missense probably benign 0.41
R1470:Pde3a UTSW 6 141,411,932 (GRCm39) missense probably benign 0.41
R1480:Pde3a UTSW 6 141,433,300 (GRCm39) missense probably benign 0.17
R1559:Pde3a UTSW 6 141,404,824 (GRCm39) missense probably damaging 1.00
R1862:Pde3a UTSW 6 141,433,239 (GRCm39) missense probably damaging 1.00
R1862:Pde3a UTSW 6 141,196,079 (GRCm39) missense probably damaging 1.00
R1902:Pde3a UTSW 6 141,444,496 (GRCm39) missense probably benign
R1909:Pde3a UTSW 6 141,195,965 (GRCm39) missense probably benign 0.00
R2048:Pde3a UTSW 6 141,434,732 (GRCm39) splice site probably benign
R2144:Pde3a UTSW 6 141,435,837 (GRCm39) missense probably benign 0.40
R2155:Pde3a UTSW 6 141,429,640 (GRCm39) missense possibly damaging 0.70
R2208:Pde3a UTSW 6 141,196,073 (GRCm39) missense probably damaging 0.97
R2405:Pde3a UTSW 6 141,426,968 (GRCm39) missense probably damaging 1.00
R4592:Pde3a UTSW 6 141,404,942 (GRCm39) missense probably benign 0.13
R4677:Pde3a UTSW 6 141,411,865 (GRCm39) missense probably benign 0.02
R4803:Pde3a UTSW 6 141,404,812 (GRCm39) missense probably damaging 1.00
R4887:Pde3a UTSW 6 141,416,668 (GRCm39) missense possibly damaging 0.94
R4999:Pde3a UTSW 6 141,195,751 (GRCm39) missense probably benign 0.00
R5055:Pde3a UTSW 6 141,433,682 (GRCm39) nonsense probably null
R5181:Pde3a UTSW 6 141,426,981 (GRCm39) critical splice donor site probably null
R5640:Pde3a UTSW 6 141,429,641 (GRCm39) missense probably damaging 0.99
R5694:Pde3a UTSW 6 141,196,228 (GRCm39) missense possibly damaging 0.48
R6176:Pde3a UTSW 6 141,444,615 (GRCm39) missense possibly damaging 0.96
R6394:Pde3a UTSW 6 141,433,237 (GRCm39) missense probably damaging 1.00
R6692:Pde3a UTSW 6 141,425,072 (GRCm39) missense probably damaging 1.00
R6968:Pde3a UTSW 6 141,433,658 (GRCm39) missense probably damaging 1.00
R7137:Pde3a UTSW 6 141,444,472 (GRCm39) missense probably benign 0.26
R7163:Pde3a UTSW 6 141,433,270 (GRCm39) missense probably damaging 1.00
R7677:Pde3a UTSW 6 141,195,983 (GRCm39) missense probably damaging 1.00
R7754:Pde3a UTSW 6 141,404,975 (GRCm39) missense probably benign 0.32
R8037:Pde3a UTSW 6 141,429,650 (GRCm39) missense possibly damaging 0.82
R8123:Pde3a UTSW 6 141,411,917 (GRCm39) missense probably benign 0.00
R8206:Pde3a UTSW 6 141,433,611 (GRCm39) missense probably damaging 1.00
R8262:Pde3a UTSW 6 141,433,527 (GRCm39) missense possibly damaging 0.89
R8376:Pde3a UTSW 6 141,426,947 (GRCm39) missense possibly damaging 0.50
R8893:Pde3a UTSW 6 141,405,522 (GRCm39) missense probably damaging 1.00
R9037:Pde3a UTSW 6 141,416,832 (GRCm39) missense probably damaging 1.00
R9158:Pde3a UTSW 6 141,195,614 (GRCm39) missense probably benign
R9222:Pde3a UTSW 6 141,437,904 (GRCm39) missense probably damaging 1.00
R9318:Pde3a UTSW 6 141,425,202 (GRCm39) missense probably benign 0.01
R9385:Pde3a UTSW 6 141,437,982 (GRCm39) missense probably benign 0.30
X0053:Pde3a UTSW 6 141,429,695 (GRCm39) splice site probably null
X0062:Pde3a UTSW 6 141,195,710 (GRCm39) missense probably damaging 1.00
Z1177:Pde3a UTSW 6 141,196,195 (GRCm39) missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- TCAGCCTGTATTGTTCAACACCTGC -3'
(R):5'- GGTCATGTCCATCAGGCCCTAAAG -3'

Sequencing Primer
(F):5'- GCCTAAAGTGTGGTCTCTGATAAAG -3'
(R):5'- CCCTAAAGTACTCTGCGGTTAAG -3'
Posted On 2014-05-09