Incidental Mutation 'R1462:Prkcb'

• ID: 186315
• Institutional Source: Beutler Lab
• Gene Symbol: Prkcb
• Ensembl Gene: ENSMUSG00000052889
• Gene Name: protein kinase C, beta
• Synonyms: Pkcb, Prkcb2, Prkcb1, A130082F03Rik, PKC-Beta
• MMRRC Submission: 039516-MU
• Essential gene?: Non essential (E-score: 0.000)
• Stock #: R1462 (G1)
• Quality Score: 225
• Status: Validated
• Chromosome: 7
• Chromosomal Location: 122288751-122634402 bp(+) (GRCm38)
• Type of Mutation: missense
• DNA Base Change (assembly): T to A at 122582449 bp (GRCm38)
• Zygosity: Heterozygous
• Amino Acid Change: Methionine to Lysine at position 420 (M420K)
• Ref Sequence: ENSEMBL: ENSMUSP00000138788
• Gene Model: predicted gene model for transcript(s): [ENSMUST00000064921] [ENSMUST00000064989] [ENSMUST00000143692]
• AlphaFold: P68404
• Predicted Effect: probably damaging; Transcript: ENSMUST00000064921; AA Change: M420K; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
• SMART Domains: Protein: ENSMUSP00000064812; Gene: ENSMUSG00000052889; AA Change: M420K

Domain	Start	End	E-Value	Type
low complexity region	4	16	N/A	INTRINSIC
C1	37	86	7.11e-16	SMART
C1	102	151	1.42e-15	SMART
C2	172	275	1.05e-23	SMART
S_TKc	342	600	4.36e-97	SMART
S_TK_X	601	664	9.86e-27	SMART

• Predicted Effect: probably damaging; Transcript: ENSMUST00000064989; AA Change: M420K; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
• SMART Domains: Protein: ENSMUSP00000070019; Gene: ENSMUSG00000052889; AA Change: M420K

Domain	Start	End	E-Value	Type
low complexity region	4	16	N/A	INTRINSIC
C1	37	86	7.11e-16	SMART
C1	102	151	1.42e-15	SMART
C2	172	275	1.05e-23	SMART
S_TKc	342	600	4.36e-97	SMART
S_TK_X	601	663	6.27e-20	SMART

• Predicted Effect: probably damaging; Transcript: ENSMUST00000143692; AA Change: M420K; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
• SMART Domains: Protein: ENSMUSP00000138788; Gene: ENSMUSG00000052889; AA Change: M420K

Domain	Start	End	E-Value	Type
low complexity region	4	16	N/A	INTRINSIC
C1	37	86	7.11e-16	SMART
C1	102	151	1.42e-15	SMART
C2	172	275	1.05e-23	SMART
S_TKc	342	600	4.36e-97	SMART
S_TK_X	601	663	6.27e-20	SMART

• Meta Mutation Damage Score: 0.9605
• Coding Region Coverage:
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 92.0%
• Validation Efficiency: 99% (83/84)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This protein kinase has been reported to be involved in many different cellular functions, such as B cell activation, apoptosis induction, endothelial cell proliferation, and intestinal sugar absorption. Studies in mice also suggest that this kinase may also regulate neuronal functions and correlate fear-induced conflict behavior after stress. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mice homozygous for a null allele exhibit impaired humoral immune responses, altered proliferative responses of B cells to various stimuli, abnormal vascular wound healing, and deficits in contextual and cued fear conditioning. ENU-induced mutations leadto impaired T cell-independent IgM responses. [provided by MGI curators]
• Posted On: 2014-05-09

Predicted Primers

PCR Primer
(F):5'- TACAGTGGCTCAGAGGTCACCCTTAG -3'
(R):5'- AGGTCTAGAATCTTGGCGGTTCCC -3'

Sequencing Primer
(F):5'- GTCACCCTTAGTGGGTGC -3'
(R):5'- tctctccctcaccgtacc -3'