Mutagenetix > Incidental Mutation

Incidental Mutation 'R1462:Adgra1'

186318

Institutional Source

Beutler Lab

Gene Symbol

Adgra1

Ensembl Gene

ENSMUSG00000025475

Gene Name

adhesion G protein-coupled receptor A1

Synonyms

Gpr123, D7Ertd680e, 2900059M17Rik

MMRRC Submission

039516-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.093) question?

Stock #

R1462 (G1)

Quality Score

167

Status

Validated

Chromosome

Chromosomal Location

139834174-139878088 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 139875829 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 458 (Y458N)

Ref Sequence

ENSEMBL: ENSMUSP00000026548 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026548]

AlphaFold

Q8C4G9

Predicted Effect

probably damaging
Transcript: ENSMUST00000026548
AA Change: Y458N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000026548
Gene: ENSMUSG00000025475
AA Change: Y458N

Domain	Start	End	E-Value	Type
Pfam:7tm_2	19	307	1.4e-16	PFAM
low complexity region	407	419	N/A	INTRINSIC
low complexity region	423	434	N/A	INTRINSIC
low complexity region	469	481	N/A	INTRINSIC

Meta Mutation Damage Score

0.0920

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.0%
20x: 92.0%

Validation Efficiency

99% (83/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the adhesion family of G-protein-coupled receptors. Members of this family function in several sensory systems and regulate blood pressure, immune responses, food intake and development. A similar protein in rodents is thought to play a role in in the regulation of neuronal signaling pathways. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Mar 2014]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	C	A	7: 40,992,946	S104*	probably null	Het
A430093F15Rik	A	T	19: 10,785,481		probably benign	Het
Abca13	T	A	11: 9,483,924		probably benign	Het
Abca9	T	C	11: 110,160,516	D118G	probably benign	Het
AC239677.1	T	A	5: 25,951,625	I119F	possibly damaging	Het
Adamts16	A	G	13: 70,836,134	F137L	probably benign	Het
Adamts3	T	C	5: 89,861,349	I152V	probably benign	Het
Adcy4	T	A	14: 55,778,308	E441D	possibly damaging	Het
Atpaf1	C	T	4: 115,784,953		probably benign	Het
Bhlhe22	C	G	3: 18,055,782	S332C	probably damaging	Het
Card19	T	A	13: 49,205,284	Q71L	probably benign	Het
Ccdc12	T	C	9: 110,656,594	L11P	probably damaging	Het
Ccdc129	A	G	6: 55,975,664	H864R	probably damaging	Het
Cdadc1	A	G	14: 59,575,858	Y367H	probably damaging	Het
Cdc5l	G	T	17: 45,408,362	Q542K	possibly damaging	Het
Cep170	T	C	1: 176,756,645	K723E	possibly damaging	Het
Cep70	A	G	9: 99,263,720	I147V	probably benign	Het
Cfap58	A	T	19: 47,962,430	H410L	probably damaging	Het
Chat	T	C	14: 32,420,778	K418R	probably damaging	Het
Cic	T	G	7: 25,271,607	D254E	probably damaging	Het
Ckap4	T	C	10: 84,527,567	E544G	probably damaging	Het
Crnkl1	C	T	2: 145,921,819	A500T	probably damaging	Het
Cyp2c38	T	C	19: 39,392,188	N418D	probably damaging	Het
Daam1	A	T	12: 71,944,142	I177L	unknown	Het
Dnah1	T	C	14: 31,268,781		probably benign	Het
Ercc5	A	G	1: 44,180,624	T1019A	probably damaging	Het
F13b	T	A	1: 139,507,636	V173E	probably damaging	Het
Fam126a	A	G	5: 23,985,732		probably benign	Het
Fam135b	A	G	15: 71,621,996		probably benign	Het
Fam20a	A	C	11: 109,677,317	F316V	probably damaging	Het
Flrt2	T	C	12: 95,779,338	V150A	probably damaging	Het
Fnta	A	C	8: 25,999,571		probably null	Het
Ghsr	A	G	3: 27,371,876	D27G	probably benign	Het
Glis3	G	T	19: 28,262,518		probably benign	Het
Gm5155	T	G	7: 17,915,591		noncoding transcript	Het
Gtpbp1	A	G	15: 79,707,885	N96D	probably damaging	Het
H1fnt	A	T	15: 98,256,573	W232R	unknown	Het
Ibtk	A	T	9: 85,724,145	I443N	probably damaging	Het
Ifi207	T	C	1: 173,724,947	H968R	probably damaging	Het
Ifit2	A	G	19: 34,573,186	D42G	probably null	Het
Il17rc	A	T	6: 113,478,989	D265V	probably damaging	Het
Ints10	G	A	8: 68,807,644		probably benign	Het
Itfg2	T	C	6: 128,424,728	D29G	probably damaging	Het
Kcng3	A	T	17: 83,631,063	C186S	probably damaging	Het
Lrrc1	A	G	9: 77,442,265	F295L	probably benign	Het
Mrps28	T	A	3: 8,900,124	H85L	possibly damaging	Het
Mtpn	T	A	6: 35,522,758	K37M	possibly damaging	Het
Mug1	C	T	6: 121,882,629	H1196Y	probably benign	Het
Mup4	T	C	4: 59,960,084	H60R	possibly damaging	Het
Musk	A	G	4: 58,286,204		probably benign	Het
Mybl2	T	C	2: 163,072,708	S249P	probably benign	Het
Naip6	A	G	13: 100,300,240	Y592H	possibly damaging	Het
Nrp1	A	G	8: 128,502,798	N919S	probably benign	Het
Nudt9	C	T	5: 104,065,038	Q326*	probably null	Het
Olfr1136	A	T	2: 87,693,376	C169S	probably damaging	Het
Olfr813	A	G	10: 129,857,231	T238A	probably damaging	Het
Olfr827	T	A	10: 130,210,723	I136F	probably benign	Het
Olfr829	T	A	9: 18,857,111	M162K	probably benign	Het
Pcsk4	T	C	10: 80,325,981	E142G	probably damaging	Het
Pde3a	C	A	6: 141,459,834	P471T	probably benign	Het
Pign	A	T	1: 105,585,002	V652E	possibly damaging	Het
Prkcb	T	A	7: 122,582,449	M420K	probably damaging	Het
Prr14	T	A	7: 127,473,988		probably null	Het
Rchy1	T	A	5: 91,957,882	Q69L	probably damaging	Het
Sccpdh	A	C	1: 179,681,560		probably benign	Het
Sec23ip	T	G	7: 128,766,138	S625A	probably benign	Het
Smpdl3b	A	G	4: 132,746,614	S47P	probably damaging	Het
Stil	G	A	4: 115,023,964	M568I	probably benign	Het
Syt3	T	A	7: 44,396,010	V558E	probably damaging	Het
Sytl3	A	G	17: 6,706,031		probably benign	Het
Szt2	A	G	4: 118,373,967	V2533A	unknown	Het
Tenm4	A	G	7: 96,704,153	Y384C	probably damaging	Het
Tfam	T	C	10: 71,235,550	E94G	probably damaging	Het
Tmbim7	A	G	5: 3,664,304	T14A	probably damaging	Het
Tmtc2	A	T	10: 105,573,705	Y15*	probably null	Het
Uhrf1	C	T	17: 56,318,035	A526V	probably damaging	Het
Vmn2r67	T	C	7: 85,155,838	D22G	probably benign	Het
Vmn2r96	A	G	17: 18,597,398	I412M	possibly damaging	Het
Vmn2r-ps69	T	A	7: 85,310,352		noncoding transcript	Het
Wdr17	A	T	8: 54,670,328	I479K	probably damaging	Het
Wt1	T	C	2: 105,166,831	V371A	probably damaging	Het
Zfp536	G	T	7: 37,479,310	S226Y	probably damaging	Het
Zfp827	T	C	8: 79,076,479	V560A	probably benign	Het

Other mutations in Adgra1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Adgra1	APN	7	139875944	missense	probably benign	0.01
IGL01014:Adgra1	APN	7	139875660	missense	probably benign	0.05
IGL01014:Adgra1	APN	7	139875661	missense	probably damaging	1.00
IGL01068:Adgra1	APN	7	139845625	missense	probably damaging	0.96
IGL01095:Adgra1	APN	7	139845654	missense	possibly damaging	0.79
IGL02717:Adgra1	APN	7	139876178	missense	probably damaging	0.98
adaga	UTSW	7	139875280	missense	probably damaging	1.00
I2288:Adgra1	UTSW	7	139852579	missense	probably damaging	0.98
R0630:Adgra1	UTSW	7	139852584	nonsense	probably null
R0653:Adgra1	UTSW	7	139876147	missense	probably damaging	0.98
R1388:Adgra1	UTSW	7	139874003	missense	probably damaging	0.97
R1462:Adgra1	UTSW	7	139875829	missense	probably damaging	1.00
R1667:Adgra1	UTSW	7	139845648	missense	possibly damaging	0.95
R1770:Adgra1	UTSW	7	139874031	nonsense	probably null
R2083:Adgra1	UTSW	7	139875631	missense	probably damaging	0.99
R2967:Adgra1	UTSW	7	139875685	missense	possibly damaging	0.68
R3410:Adgra1	UTSW	7	139847703	missense	possibly damaging	0.94
R3411:Adgra1	UTSW	7	139847703	missense	possibly damaging	0.94
R3687:Adgra1	UTSW	7	139852590	missense	probably damaging	1.00
R3804:Adgra1	UTSW	7	139845594	missense	probably benign	0.01
R3912:Adgra1	UTSW	7	139845714	critical splice donor site	probably null
R4452:Adgra1	UTSW	7	139852521	missense	probably benign	0.02
R4466:Adgra1	UTSW	7	139840836	intron	probably benign
R4469:Adgra1	UTSW	7	139876061	missense	probably damaging	0.96
R4675:Adgra1	UTSW	7	139876186	missense	probably damaging	1.00
R4724:Adgra1	UTSW	7	139875589	missense	probably benign
R5220:Adgra1	UTSW	7	139875596	missense	probably benign	0.06
R5846:Adgra1	UTSW	7	139875280	missense	probably damaging	1.00
R5972:Adgra1	UTSW	7	139845667	missense	probably damaging	1.00
R6453:Adgra1	UTSW	7	139875427	missense	probably benign	0.09
R7242:Adgra1	UTSW	7	139847657	critical splice acceptor site	probably null
R7343:Adgra1	UTSW	7	139876142	missense	probably damaging	1.00
R7774:Adgra1	UTSW	7	139847712	missense	possibly damaging	0.79
R8190:Adgra1	UTSW	7	139876118	missense	probably benign
R8355:Adgra1	UTSW	7	139875651	nonsense	probably null
R8455:Adgra1	UTSW	7	139875651	nonsense	probably null
R8905:Adgra1	UTSW	7	139875847	missense	probably damaging	1.00
R9045:Adgra1	UTSW	7	139852650	missense	possibly damaging	0.64
R9056:Adgra1	UTSW	7	139852576	missense	probably damaging	1.00
R9183:Adgra1	UTSW	7	139875800	missense	probably benign	0.24
R9438:Adgra1	UTSW	7	139852609	missense	probably benign	0.00
V1662:Adgra1	UTSW	7	139852579	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGCACTGTGAGCAGTTAATGGAGG -3'
(R):5'- GGCGAAGAAGTTGTGTTCCCAACC -3'

Sequencing Primer
(F):5'- CAGTTAATGGAGGAGGAGGC -3'
(R):5'- TAGCATCTCCAAGTGGGCAG -3'

Posted On

2014-05-09