Incidental Mutation 'R1462:Cdadc1'
ID 186346
Institutional Source Beutler Lab
Gene Symbol Cdadc1
Ensembl Gene ENSMUSG00000021982
Gene Name cytidine and dCMP deaminase domain containing 1
Synonyms 2310010M10Rik, NYD-SP15
MMRRC Submission 039516-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock # R1462 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 59559388-59597959 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 59575858 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 367 (Y367H)
Ref Sequence ENSEMBL: ENSMUSP00000153357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022555] [ENSMUST00000056997] [ENSMUST00000167100] [ENSMUST00000171683] [ENSMUST00000225595] [ENSMUST00000225839]
AlphaFold Q8BMD5
Predicted Effect probably damaging
Transcript: ENSMUST00000022555
AA Change: Y367H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022555
Gene: ENSMUSG00000021982
AA Change: Y367H

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 73 153 9.2e-8 PFAM
Pfam:dCMP_cyt_deam_1 317 446 4.2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000056997
AA Change: Y367H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052233
Gene: ENSMUSG00000021982
AA Change: Y367H

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 73 153 9.8e-8 PFAM
Pfam:dCMP_cyt_deam_1 317 446 4.6e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167100
AA Change: Y367H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128022
Gene: ENSMUSG00000021982
AA Change: Y367H

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 74 153 4.9e-9 PFAM
Pfam:dCMP_cyt_deam_1 317 446 1.1e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171683
AA Change: Y367H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128064
Gene: ENSMUSG00000021982
AA Change: Y367H

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 74 153 1.4e-8 PFAM
Pfam:dCMP_cyt_deam_1 317 446 3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225595
Predicted Effect probably damaging
Transcript: ENSMUST00000225839
AA Change: Y367H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.7401 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency 99% (83/84)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C A 7: 40,992,946 S104* probably null Het
A430093F15Rik A T 19: 10,785,481 probably benign Het
Abca13 T A 11: 9,483,924 probably benign Het
Abca9 T C 11: 110,160,516 D118G probably benign Het
AC239677.1 T A 5: 25,951,625 I119F possibly damaging Het
Adamts16 A G 13: 70,836,134 F137L probably benign Het
Adamts3 T C 5: 89,861,349 I152V probably benign Het
Adcy4 T A 14: 55,778,308 E441D possibly damaging Het
Adgra1 T A 7: 139,875,829 Y458N probably damaging Het
Atpaf1 C T 4: 115,784,953 probably benign Het
Bhlhe22 C G 3: 18,055,782 S332C probably damaging Het
Card19 T A 13: 49,205,284 Q71L probably benign Het
Ccdc12 T C 9: 110,656,594 L11P probably damaging Het
Ccdc129 A G 6: 55,975,664 H864R probably damaging Het
Cdc5l G T 17: 45,408,362 Q542K possibly damaging Het
Cep170 T C 1: 176,756,645 K723E possibly damaging Het
Cep70 A G 9: 99,263,720 I147V probably benign Het
Cfap58 A T 19: 47,962,430 H410L probably damaging Het
Chat T C 14: 32,420,778 K418R probably damaging Het
Cic T G 7: 25,271,607 D254E probably damaging Het
Ckap4 T C 10: 84,527,567 E544G probably damaging Het
Crnkl1 C T 2: 145,921,819 A500T probably damaging Het
Cyp2c38 T C 19: 39,392,188 N418D probably damaging Het
Daam1 A T 12: 71,944,142 I177L unknown Het
Dnah1 T C 14: 31,268,781 probably benign Het
Ercc5 A G 1: 44,180,624 T1019A probably damaging Het
F13b T A 1: 139,507,636 V173E probably damaging Het
Fam126a A G 5: 23,985,732 probably benign Het
Fam135b A G 15: 71,621,996 probably benign Het
Fam20a A C 11: 109,677,317 F316V probably damaging Het
Flrt2 T C 12: 95,779,338 V150A probably damaging Het
Fnta A C 8: 25,999,571 probably null Het
Ghsr A G 3: 27,371,876 D27G probably benign Het
Glis3 G T 19: 28,262,518 probably benign Het
Gm5155 T G 7: 17,915,591 noncoding transcript Het
Gtpbp1 A G 15: 79,707,885 N96D probably damaging Het
H1fnt A T 15: 98,256,573 W232R unknown Het
Ibtk A T 9: 85,724,145 I443N probably damaging Het
Ifi207 T C 1: 173,724,947 H968R probably damaging Het
Ifit2 A G 19: 34,573,186 D42G probably null Het
Il17rc A T 6: 113,478,989 D265V probably damaging Het
Ints10 G A 8: 68,807,644 probably benign Het
Itfg2 T C 6: 128,424,728 D29G probably damaging Het
Kcng3 A T 17: 83,631,063 C186S probably damaging Het
Lrrc1 A G 9: 77,442,265 F295L probably benign Het
Mrps28 T A 3: 8,900,124 H85L possibly damaging Het
Mtpn T A 6: 35,522,758 K37M possibly damaging Het
Mug1 C T 6: 121,882,629 H1196Y probably benign Het
Mup4 T C 4: 59,960,084 H60R possibly damaging Het
Musk A G 4: 58,286,204 probably benign Het
Mybl2 T C 2: 163,072,708 S249P probably benign Het
Naip6 A G 13: 100,300,240 Y592H possibly damaging Het
Nrp1 A G 8: 128,502,798 N919S probably benign Het
Nudt9 C T 5: 104,065,038 Q326* probably null Het
Olfr1136 A T 2: 87,693,376 C169S probably damaging Het
Olfr813 A G 10: 129,857,231 T238A probably damaging Het
Olfr827 T A 10: 130,210,723 I136F probably benign Het
Olfr829 T A 9: 18,857,111 M162K probably benign Het
Pcsk4 T C 10: 80,325,981 E142G probably damaging Het
Pde3a C A 6: 141,459,834 P471T probably benign Het
Pign A T 1: 105,585,002 V652E possibly damaging Het
Prkcb T A 7: 122,582,449 M420K probably damaging Het
Prr14 T A 7: 127,473,988 probably null Het
Rchy1 T A 5: 91,957,882 Q69L probably damaging Het
Sccpdh A C 1: 179,681,560 probably benign Het
Sec23ip T G 7: 128,766,138 S625A probably benign Het
Smpdl3b A G 4: 132,746,614 S47P probably damaging Het
Stil G A 4: 115,023,964 M568I probably benign Het
Syt3 T A 7: 44,396,010 V558E probably damaging Het
Sytl3 A G 17: 6,706,031 probably benign Het
Szt2 A G 4: 118,373,967 V2533A unknown Het
Tenm4 A G 7: 96,704,153 Y384C probably damaging Het
Tfam T C 10: 71,235,550 E94G probably damaging Het
Tmbim7 A G 5: 3,664,304 T14A probably damaging Het
Tmtc2 A T 10: 105,573,705 Y15* probably null Het
Uhrf1 C T 17: 56,318,035 A526V probably damaging Het
Vmn2r67 T C 7: 85,155,838 D22G probably benign Het
Vmn2r96 A G 17: 18,597,398 I412M possibly damaging Het
Vmn2r-ps69 T A 7: 85,310,352 noncoding transcript Het
Wdr17 A T 8: 54,670,328 I479K probably damaging Het
Wt1 T C 2: 105,166,831 V371A probably damaging Het
Zfp536 G T 7: 37,479,310 S226Y probably damaging Het
Zfp827 T C 8: 79,076,479 V560A probably benign Het
Other mutations in Cdadc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Cdadc1 APN 14 59581369 missense probably damaging 1.00
IGL01897:Cdadc1 APN 14 59592537 critical splice acceptor site probably null
IGL02648:Cdadc1 APN 14 59586363 missense probably damaging 1.00
IGL02720:Cdadc1 APN 14 59586047 missense probably damaging 1.00
R0254:Cdadc1 UTSW 14 59575907 splice site probably benign
R0470:Cdadc1 UTSW 14 59573841 splice site probably benign
R0554:Cdadc1 UTSW 14 59586452 missense probably damaging 1.00
R1462:Cdadc1 UTSW 14 59575858 missense probably damaging 1.00
R1540:Cdadc1 UTSW 14 59586083 missense probably damaging 1.00
R1540:Cdadc1 UTSW 14 59586092 missense probably damaging 1.00
R1649:Cdadc1 UTSW 14 59573793 missense probably damaging 1.00
R1900:Cdadc1 UTSW 14 59586532 missense probably damaging 1.00
R1934:Cdadc1 UTSW 14 59589860 missense possibly damaging 0.91
R1976:Cdadc1 UTSW 14 59573768 missense probably damaging 1.00
R2061:Cdadc1 UTSW 14 59581334 missense probably damaging 1.00
R2136:Cdadc1 UTSW 14 59568044 splice site probably null
R2147:Cdadc1 UTSW 14 59597753 critical splice donor site probably null
R2929:Cdadc1 UTSW 14 59597835 start codon destroyed probably null 0.70
R2991:Cdadc1 UTSW 14 59586072 missense possibly damaging 0.68
R4179:Cdadc1 UTSW 14 59592486 missense probably benign 0.12
R4621:Cdadc1 UTSW 14 59586555 missense probably benign 0.00
R4814:Cdadc1 UTSW 14 59568991 frame shift probably null
R4816:Cdadc1 UTSW 14 59568991 frame shift probably null
R4817:Cdadc1 UTSW 14 59568991 frame shift probably null
R4872:Cdadc1 UTSW 14 59564524 missense probably benign 0.04
R5448:Cdadc1 UTSW 14 59573826 missense possibly damaging 0.94
R5642:Cdadc1 UTSW 14 59589923 missense possibly damaging 0.95
R5732:Cdadc1 UTSW 14 59596911 missense probably damaging 0.99
R6472:Cdadc1 UTSW 14 59586042 missense probably damaging 0.99
R6501:Cdadc1 UTSW 14 59586449 missense probably benign 0.00
R7332:Cdadc1 UTSW 14 59575764 missense possibly damaging 0.63
R7763:Cdadc1 UTSW 14 59573834 missense probably damaging 1.00
R8978:Cdadc1 UTSW 14 59575748 missense probably damaging 1.00
X0064:Cdadc1 UTSW 14 59575854 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGAACTAGGCTCAACCATCCTCTG -3'
(R):5'- AGTAGCCGAGAAGCAGTTATTGATGTG -3'

Sequencing Primer
(F):5'- GCTCAACCATCCTCTGTTGTC -3'
(R):5'- aaaagcacagccatttctcc -3'
Posted On 2014-05-09