Incidental Mutation 'R1462:Vmn2r96'
ID 186351
Institutional Source Beutler Lab
Gene Symbol Vmn2r96
Ensembl Gene ENSMUSG00000091679
Gene Name vomeronasal 2, receptor 96
Synonyms EG433070
MMRRC Submission 039516-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.156) question?
Stock # R1462 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 18793282-18818419 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 18817660 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 412 (I412M)
Ref Sequence ENSEMBL: ENSMUSP00000131564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165692] [ENSMUST00000177244] [ENSMUST00000231261] [ENSMUST00000231286]
AlphaFold E9PZU5
Predicted Effect possibly damaging
Transcript: ENSMUST00000165692
AA Change: I412M

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131564
Gene: ENSMUSG00000091679
AA Change: I412M

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 257 8.6e-20 PFAM
Pfam:NCD3G 317 370 3.7e-22 PFAM
Pfam:7tm_3 402 638 3.9e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177244
AA Change: I604M

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135095
Gene: ENSMUSG00000091679
AA Change: I604M

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 245 4.2e-19 PFAM
Pfam:NCD3G 317 370 6.9e-21 PFAM
Pfam:7tm_3 400 639 3.4e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231261
Predicted Effect probably benign
Transcript: ENSMUST00000231286
AA Change: I604M

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency 99% (83/84)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C A 7: 40,642,370 (GRCm39) S104* probably null Het
A430093F15Rik A T 19: 10,762,845 (GRCm39) probably benign Het
Abca13 T A 11: 9,433,924 (GRCm39) probably benign Het
Abca9 T C 11: 110,051,342 (GRCm39) D118G probably benign Het
Adamts16 A G 13: 70,984,253 (GRCm39) F137L probably benign Het
Adamts3 T C 5: 90,009,208 (GRCm39) I152V probably benign Het
Adcy4 T A 14: 56,015,765 (GRCm39) E441D possibly damaging Het
Adgra1 T A 7: 139,455,745 (GRCm39) Y458N probably damaging Het
Atpaf1 C T 4: 115,642,150 (GRCm39) probably benign Het
Bhlhe22 C G 3: 18,109,946 (GRCm39) S332C probably damaging Het
Card19 T A 13: 49,358,760 (GRCm39) Q71L probably benign Het
Ccdc12 T C 9: 110,485,662 (GRCm39) L11P probably damaging Het
Cdadc1 A G 14: 59,813,307 (GRCm39) Y367H probably damaging Het
Cdc5l G T 17: 45,719,288 (GRCm39) Q542K possibly damaging Het
Ceacam23 T G 7: 17,649,516 (GRCm39) noncoding transcript Het
Cep170 T C 1: 176,584,211 (GRCm39) K723E possibly damaging Het
Cep70 A G 9: 99,145,773 (GRCm39) I147V probably benign Het
Cfap58 A T 19: 47,950,869 (GRCm39) H410L probably damaging Het
Chat T C 14: 32,142,735 (GRCm39) K418R probably damaging Het
Cic T G 7: 24,971,032 (GRCm39) D254E probably damaging Het
Ckap4 T C 10: 84,363,431 (GRCm39) E544G probably damaging Het
Crnkl1 C T 2: 145,763,739 (GRCm39) A500T probably damaging Het
Cyp2c38 T C 19: 39,380,632 (GRCm39) N418D probably damaging Het
Daam1 A T 12: 71,990,916 (GRCm39) I177L unknown Het
Dnah1 T C 14: 30,990,738 (GRCm39) probably benign Het
Ercc5 A G 1: 44,219,784 (GRCm39) T1019A probably damaging Het
F13b T A 1: 139,435,374 (GRCm39) V173E probably damaging Het
Fam135b A G 15: 71,493,845 (GRCm39) probably benign Het
Fam20a A C 11: 109,568,143 (GRCm39) F316V probably damaging Het
Flrt2 T C 12: 95,746,112 (GRCm39) V150A probably damaging Het
Fnta A C 8: 26,489,599 (GRCm39) probably null Het
Ghsr A G 3: 27,426,025 (GRCm39) D27G probably benign Het
Glis3 G T 19: 28,239,918 (GRCm39) probably benign Het
Gtpbp1 A G 15: 79,592,086 (GRCm39) N96D probably damaging Het
H1f7 A T 15: 98,154,454 (GRCm39) W232R unknown Het
Hycc1 A G 5: 24,190,730 (GRCm39) probably benign Het
Ibtk A T 9: 85,606,198 (GRCm39) I443N probably damaging Het
Ifi207 T C 1: 173,552,513 (GRCm39) H968R probably damaging Het
Ifit2 A G 19: 34,550,586 (GRCm39) D42G probably null Het
Il17rc A T 6: 113,455,950 (GRCm39) D265V probably damaging Het
Ints10 G A 8: 69,260,296 (GRCm39) probably benign Het
Itfg2 T C 6: 128,401,691 (GRCm39) D29G probably damaging Het
Itprid1 A G 6: 55,952,649 (GRCm39) H864R probably damaging Het
Kcng3 A T 17: 83,938,492 (GRCm39) C186S probably damaging Het
Lrrc1 A G 9: 77,349,547 (GRCm39) F295L probably benign Het
Mrps28 T A 3: 8,965,184 (GRCm39) H85L possibly damaging Het
Mtpn T A 6: 35,499,693 (GRCm39) K37M possibly damaging Het
Mug1 C T 6: 121,859,588 (GRCm39) H1196Y probably benign Het
Mup4 T C 4: 59,960,084 (GRCm39) H60R possibly damaging Het
Musk A G 4: 58,286,204 (GRCm39) probably benign Het
Mybl2 T C 2: 162,914,628 (GRCm39) S249P probably benign Het
Naip6 A G 13: 100,436,748 (GRCm39) Y592H possibly damaging Het
Nrp1 A G 8: 129,229,279 (GRCm39) N919S probably benign Het
Nudt9 C T 5: 104,212,904 (GRCm39) Q326* probably null Het
Or5w13 A T 2: 87,523,720 (GRCm39) C169S probably damaging Het
Or6c76b A G 10: 129,693,100 (GRCm39) T238A probably damaging Het
Or7g17 T A 9: 18,768,407 (GRCm39) M162K probably benign Het
Or9k7 T A 10: 130,046,592 (GRCm39) I136F probably benign Het
Pcsk4 T C 10: 80,161,815 (GRCm39) E142G probably damaging Het
Pde3a C A 6: 141,405,560 (GRCm39) P471T probably benign Het
Pign A T 1: 105,512,727 (GRCm39) V652E possibly damaging Het
Prkcb T A 7: 122,181,672 (GRCm39) M420K probably damaging Het
Prr14 T A 7: 127,073,160 (GRCm39) probably null Het
Rchy1 T A 5: 92,105,741 (GRCm39) Q69L probably damaging Het
Sccpdh A C 1: 179,509,125 (GRCm39) probably benign Het
Sec23ip T G 7: 128,367,862 (GRCm39) S625A probably benign Het
Smpdl3b A G 4: 132,473,925 (GRCm39) S47P probably damaging Het
Speer4a3 T A 5: 26,156,623 (GRCm39) I119F possibly damaging Het
Stil G A 4: 114,881,161 (GRCm39) M568I probably benign Het
Syt3 T A 7: 44,045,434 (GRCm39) V558E probably damaging Het
Sytl3 A G 17: 6,973,430 (GRCm39) probably benign Het
Szt2 A G 4: 118,231,164 (GRCm39) V2533A unknown Het
Tenm4 A G 7: 96,353,360 (GRCm39) Y384C probably damaging Het
Tfam T C 10: 71,071,380 (GRCm39) E94G probably damaging Het
Tmbim7 A G 5: 3,714,304 (GRCm39) T14A probably damaging Het
Tmtc2 A T 10: 105,409,566 (GRCm39) Y15* probably null Het
Uhrf1 C T 17: 56,625,035 (GRCm39) A526V probably damaging Het
Vmn2r67 T C 7: 84,805,046 (GRCm39) D22G probably benign Het
Vmn2r-ps69 T A 7: 84,959,560 (GRCm39) noncoding transcript Het
Wdr17 A T 8: 55,123,363 (GRCm39) I479K probably damaging Het
Wt1 T C 2: 104,997,176 (GRCm39) V371A probably damaging Het
Zfp536 G T 7: 37,178,735 (GRCm39) S226Y probably damaging Het
Zfp827 T C 8: 79,803,108 (GRCm39) V560A probably benign Het
Other mutations in Vmn2r96
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Vmn2r96 APN 17 18,804,077 (GRCm39) missense probably benign 0.00
IGL00563:Vmn2r96 APN 17 18,804,077 (GRCm39) missense probably benign 0.00
IGL00769:Vmn2r96 APN 17 18,804,081 (GRCm39) missense probably benign 0.00
IGL01314:Vmn2r96 APN 17 18,803,226 (GRCm39) missense probably benign 0.00
IGL01983:Vmn2r96 APN 17 18,817,527 (GRCm39) missense probably damaging 0.99
IGL02314:Vmn2r96 APN 17 18,804,221 (GRCm39) missense probably benign 0.01
IGL02600:Vmn2r96 APN 17 18,817,829 (GRCm39) missense probably benign
IGL02672:Vmn2r96 APN 17 18,818,376 (GRCm39) missense probably benign 0.02
IGL02750:Vmn2r96 APN 17 18,802,851 (GRCm39) missense probably benign 0.01
IGL03068:Vmn2r96 APN 17 18,803,137 (GRCm39) missense probably benign 0.00
IGL03411:Vmn2r96 APN 17 18,806,634 (GRCm39) missense possibly damaging 0.88
R0316:Vmn2r96 UTSW 17 18,802,827 (GRCm39) missense probably damaging 1.00
R0502:Vmn2r96 UTSW 17 18,804,262 (GRCm39) missense probably benign
R0580:Vmn2r96 UTSW 17 18,802,900 (GRCm39) missense probably damaging 1.00
R0652:Vmn2r96 UTSW 17 18,817,830 (GRCm39) missense probably benign 0.05
R0789:Vmn2r96 UTSW 17 18,802,738 (GRCm39) missense possibly damaging 0.81
R1462:Vmn2r96 UTSW 17 18,817,660 (GRCm39) missense possibly damaging 0.94
R1660:Vmn2r96 UTSW 17 18,817,988 (GRCm39) missense probably benign 0.00
R1755:Vmn2r96 UTSW 17 18,802,915 (GRCm39) missense possibly damaging 0.50
R1843:Vmn2r96 UTSW 17 18,818,183 (GRCm39) missense probably benign 0.14
R1943:Vmn2r96 UTSW 17 18,806,664 (GRCm39) missense probably benign 0.09
R1993:Vmn2r96 UTSW 17 18,804,138 (GRCm39) missense probably damaging 1.00
R2018:Vmn2r96 UTSW 17 18,804,263 (GRCm39) missense probably benign
R2405:Vmn2r96 UTSW 17 18,818,102 (GRCm39) missense probably damaging 0.96
R3977:Vmn2r96 UTSW 17 18,817,941 (GRCm39) missense probably damaging 1.00
R3979:Vmn2r96 UTSW 17 18,817,941 (GRCm39) missense probably damaging 1.00
R4059:Vmn2r96 UTSW 17 18,818,339 (GRCm39) missense probably benign 0.20
R4693:Vmn2r96 UTSW 17 18,803,270 (GRCm39) missense probably benign 0.03
R4709:Vmn2r96 UTSW 17 18,803,088 (GRCm39) missense probably benign 0.36
R4776:Vmn2r96 UTSW 17 18,817,770 (GRCm39) missense probably damaging 1.00
R4882:Vmn2r96 UTSW 17 18,817,866 (GRCm39) missense probably damaging 1.00
R4920:Vmn2r96 UTSW 17 18,802,918 (GRCm39) missense probably benign 0.07
R5143:Vmn2r96 UTSW 17 18,804,120 (GRCm39) missense possibly damaging 0.65
R5301:Vmn2r96 UTSW 17 18,817,950 (GRCm39) missense probably damaging 0.98
R5507:Vmn2r96 UTSW 17 18,818,091 (GRCm39) missense probably damaging 1.00
R6151:Vmn2r96 UTSW 17 18,804,221 (GRCm39) missense probably benign 0.01
R6181:Vmn2r96 UTSW 17 18,804,126 (GRCm39) missense probably benign
R6339:Vmn2r96 UTSW 17 18,804,124 (GRCm39) missense possibly damaging 0.84
R6404:Vmn2r96 UTSW 17 18,817,793 (GRCm39) missense probably damaging 1.00
R6452:Vmn2r96 UTSW 17 18,804,117 (GRCm39) missense probably benign 0.07
R6749:Vmn2r96 UTSW 17 18,818,352 (GRCm39) missense probably damaging 0.99
R6813:Vmn2r96 UTSW 17 18,802,116 (GRCm39) missense probably benign 0.04
R6851:Vmn2r96 UTSW 17 18,802,800 (GRCm39) missense possibly damaging 0.95
R6944:Vmn2r96 UTSW 17 18,817,891 (GRCm39) missense probably benign 0.16
R6949:Vmn2r96 UTSW 17 18,818,100 (GRCm39) missense probably damaging 1.00
R6962:Vmn2r96 UTSW 17 18,818,283 (GRCm39) missense probably damaging 0.99
R6990:Vmn2r96 UTSW 17 18,804,082 (GRCm39) missense probably benign
R7149:Vmn2r96 UTSW 17 18,817,989 (GRCm39) missense possibly damaging 0.89
R7346:Vmn2r96 UTSW 17 18,803,029 (GRCm39) missense probably benign 0.15
R7385:Vmn2r96 UTSW 17 18,803,302 (GRCm39) missense probably damaging 1.00
R7442:Vmn2r96 UTSW 17 18,793,662 (GRCm39) missense probably benign 0.02
R7509:Vmn2r96 UTSW 17 18,802,995 (GRCm39) missense probably benign 0.02
R7652:Vmn2r96 UTSW 17 18,793,832 (GRCm39) missense probably benign
R7659:Vmn2r96 UTSW 17 18,793,749 (GRCm39) missense probably benign 0.00
R7753:Vmn2r96 UTSW 17 18,806,663 (GRCm39) missense possibly damaging 0.46
R7855:Vmn2r96 UTSW 17 18,818,130 (GRCm39) missense possibly damaging 0.59
R8166:Vmn2r96 UTSW 17 18,802,744 (GRCm39) missense probably damaging 1.00
R8260:Vmn2r96 UTSW 17 18,804,243 (GRCm39) missense probably benign 0.04
R8323:Vmn2r96 UTSW 17 18,803,023 (GRCm39) missense probably damaging 0.99
R8787:Vmn2r96 UTSW 17 18,818,250 (GRCm39) missense probably damaging 1.00
R8837:Vmn2r96 UTSW 17 18,802,888 (GRCm39) missense probably benign
R8933:Vmn2r96 UTSW 17 18,804,241 (GRCm39) missense probably benign 0.11
R9306:Vmn2r96 UTSW 17 18,803,226 (GRCm39) missense probably benign 0.00
R9481:Vmn2r96 UTSW 17 18,793,621 (GRCm39) start gained probably benign
R9626:Vmn2r96 UTSW 17 18,793,758 (GRCm39) missense probably benign 0.14
R9629:Vmn2r96 UTSW 17 18,803,257 (GRCm39) missense probably benign 0.15
Z1088:Vmn2r96 UTSW 17 18,817,628 (GRCm39) missense possibly damaging 0.86
Z1177:Vmn2r96 UTSW 17 18,818,376 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TACAGCGACTTCTGTGACAGTCCC -3'
(R):5'- CAACTGCAAATGTGGTCTGCTGG -3'

Sequencing Primer
(F):5'- CCTATGTTTCTGACCAGATGTAGAC -3'
(R):5'- CTGCTGGAGGATGCAGG -3'
Posted On 2014-05-09