Mutagenetix > Incidental Mutation

Incidental Mutation 'R1651:Map1b'

186414

Institutional Source

Beutler Lab

Gene Symbol

Map1b

Ensembl Gene

ENSMUSG00000052727

Gene Name

microtubule-associated protein 1B

Synonyms

Mtap1b, MAP5, Mtap-5, Mtap5, LC1

MMRRC Submission

039687-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1651 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99421446-99516540 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 99432583 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1210 (E1210G)

Ref Sequence

ENSEMBL: ENSMUSP00000068374 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064762]

AlphaFold

P14873

Predicted Effect

unknown
Transcript: ENSMUST00000064762
AA Change: E1210G

SMART Domains

Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: E1210G

Domain	Start	End	E-Value	Type
low complexity region	41	50	N/A	INTRINSIC
Blast:Lactamase_B	270	514	1e-56	BLAST
low complexity region	578	595	N/A	INTRINSIC
low complexity region	597	617	N/A	INTRINSIC
SCOP:d1gkub2	633	735	8e-4	SMART
low complexity region	771	813	N/A	INTRINSIC
low complexity region	855	866	N/A	INTRINSIC
low complexity region	889	913	N/A	INTRINSIC
low complexity region	935	956	N/A	INTRINSIC
low complexity region	1006	1030	N/A	INTRINSIC
low complexity region	1247	1261	N/A	INTRINSIC
low complexity region	1390	1404	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
low complexity region	1724	1735	N/A	INTRINSIC
Pfam:MAP1B_neuraxin	1891	1907	1.9e-10	PFAM
Pfam:MAP1B_neuraxin	1908	1924	8.3e-11	PFAM
Pfam:MAP1B_neuraxin	1942	1958	3.1e-9	PFAM
Pfam:MAP1B_neuraxin	1959	1975	6.2e-9	PFAM
Pfam:MAP1B_neuraxin	2027	2043	2.9e-10	PFAM
Pfam:MAP1B_neuraxin	2044	2060	3.9e-9	PFAM
low complexity region	2227	2257	N/A	INTRINSIC
low complexity region	2286	2307	N/A	INTRINSIC
low complexity region	2316	2343	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223693

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224702

Meta Mutation Damage Score

0.1316

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.0%

Validation Efficiency

97% (66/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd12	T	A	2: 150,848,421	Q118L	probably benign	Het
Acss1	A	T	2: 150,638,437	V238D	possibly damaging	Het
Adgrv1	T	C	13: 81,487,853	I3512M	probably benign	Het
Arhgap32	A	G	9: 32,259,800	Q1292R	probably damaging	Het
Caskin1	C	T	17: 24,502,212	R509C	possibly damaging	Het
Cd47	T	C	16: 49,894,228	V147A	possibly damaging	Het
Cdc20b	T	A	13: 113,078,724	Y275*	probably null	Het
Chd4	A	G	6: 125,123,584	D1745G	possibly damaging	Het
Crmp1	T	A	5: 37,273,439	S250T	probably damaging	Het
Crybg2	C	A	4: 134,074,825	P1099T	possibly damaging	Het
Crybg2	A	G	4: 134,074,903	K1125E	probably benign	Het
Csf1r	T	A	18: 61,110,401	I163N	possibly damaging	Het
Dicer1	T	C	12: 104,708,805	T733A	probably damaging	Het
Edar	A	G	10: 58,606,053	V339A	possibly damaging	Het
Efcab6	A	G	15: 83,870,993	I1374T	possibly damaging	Het
Erbb2	G	A	11: 98,433,457	R757K	probably damaging	Het
Fam98a	A	G	17: 75,547,715	V33A	probably benign	Het
Farp2	T	C	1: 93,603,469		probably null	Het
Fcmr	A	G	1: 130,878,251	T315A	probably benign	Het
Gdf9	G	A	11: 53,433,749	R115Q	probably damaging	Het
Gm11639	A	G	11: 104,720,666	R445G	probably benign	Het
Gm22697+Rbm27	AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC	AGGTCCCGGCCCAGGCCC	18: 42,301,883		probably benign	Het
Gm428	A	T	4: 73,687,384	N344I	possibly damaging	Het
H2-M10.1	A	G	17: 36,325,756	V52A	probably damaging	Het
Hspg2	T	A	4: 137,533,437	C1582*	probably null	Het
Icam2	C	T	11: 106,377,956	V229M	probably damaging	Het
Impad1	A	G	4: 4,792,737	F123L	probably damaging	Het
Itga7	C	T	10: 128,948,824	P735L	probably benign	Het
Kbtbd3	C	A	9: 4,330,589	P321Q	possibly damaging	Het
Kcnma1	T	A	14: 23,314,194	T997S	probably damaging	Het
Kifc5b	T	C	17: 26,925,530	F541S	probably damaging	Het
Klhdc9	C	A	1: 171,360,448	V72L	probably benign	Het
Krt84	G	A	15: 101,525,963	S523F	possibly damaging	Het
Lrrtm4	A	G	6: 80,022,528	T308A	probably benign	Het
Mocs3	A	G	2: 168,231,569	Y312C	probably damaging	Het
Mrps7	G	T	11: 115,604,755	E40*	probably null	Het
Msln	T	C	17: 25,753,408	H50R	probably benign	Het
Myb	A	G	10: 21,126,198	F748S	probably damaging	Het
Myo10	C	A	15: 25,742,369	H590N	probably damaging	Het
Naip5	T	C	13: 100,221,911	E939G	probably benign	Het
Nbeal1	T	A	1: 60,200,119	V107E	probably damaging	Het
Nrcam	A	T	12: 44,576,679	N1011I	probably damaging	Het
Olfr1223	A	C	2: 89,145,002	V7G	probably damaging	Het
Olfr301	A	G	7: 86,407,870		probably benign	Het
Olfr356	T	C	2: 36,937,323	L68P	probably damaging	Het
Pcgf6	A	T	19: 47,049,002	C153S	probably damaging	Het
Phrf1	T	C	7: 141,237,521	V81A	probably benign	Het
Ppp4r4	A	G	12: 103,584,072	N36D	probably benign	Het
Prkch	A	G	12: 73,759,001	T517A	possibly damaging	Het
Rasal1	A	T	5: 120,652,845	K33*	probably null	Het
Rp1l1	G	A	14: 64,030,993	E1343K	probably damaging	Het
Serpinb6e	T	C	13: 33,836,423	D234G	probably benign	Het
Setd2	A	G	9: 110,549,864	S632G	probably benign	Het
Smyd3	T	G	1: 179,043,876	I313L	probably benign	Het
Tdrd9	C	A	12: 112,024,706	D543E	probably damaging	Het
Tet1	A	G	10: 62,879,674	L114P	probably damaging	Het
Tmprss11c	G	A	5: 86,239,424	P212S	probably damaging	Het
Tmx2	A	T	2: 84,676,117	M77K	probably damaging	Het
Traf3	T	G	12: 111,262,036	D560E	probably damaging	Het
Trappc12	C	T	12: 28,691,777	M711I	probably benign	Het
Trim2	A	G	3: 84,167,650		probably null	Het
Vmn2r18	A	G	5: 151,561,999	S677P	probably damaging	Het
Wdr7	T	A	18: 63,720,776	L60*	probably null	Het
Wdr93	T	C	7: 79,750,082	F140L	probably benign	Het
Zfp638	A	G	6: 83,954,737	T802A	probably benign	Het

Other mutations in Map1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Map1b	APN	13	99429233	missense	unknown
IGL00533:Map1b	APN	13	99432604	missense	unknown
IGL00801:Map1b	APN	13	99430097	missense	unknown
IGL01141:Map1b	APN	13	99434761	missense	probably damaging	1.00
IGL01418:Map1b	APN	13	99431830	missense	unknown
IGL01464:Map1b	APN	13	99432743	missense	unknown
IGL01690:Map1b	APN	13	99435004	missense	probably damaging	1.00
IGL01991:Map1b	APN	13	99429569	missense	unknown
IGL02245:Map1b	APN	13	99431528	missense	unknown
IGL02376:Map1b	APN	13	99435595	missense	probably damaging	1.00
IGL02380:Map1b	APN	13	99431143	missense	unknown
IGL02442:Map1b	APN	13	99508198	missense	probably damaging	1.00
IGL02465:Map1b	APN	13	99433406	missense	unknown
IGL02816:Map1b	APN	13	99441755	missense	probably damaging	1.00
IGL02859:Map1b	APN	13	99433036	missense	unknown
IGL02934:Map1b	APN	13	99435131	missense	probably benign	0.09
IGL02970:Map1b	APN	13	99430734	nonsense	probably null
IGL03148:Map1b	APN	13	99441695	missense	probably damaging	1.00
IGL03401:Map1b	APN	13	99427268	missense	unknown
IGL03138:Map1b	UTSW	13	99425826	missense	unknown
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0035:Map1b	UTSW	13	99435338	missense	probably damaging	1.00
R0069:Map1b	UTSW	13	99429848	missense	unknown
R0315:Map1b	UTSW	13	99431116	missense	unknown
R0539:Map1b	UTSW	13	99434018	missense	unknown
R0548:Map1b	UTSW	13	99431683	missense	unknown
R0613:Map1b	UTSW	13	99441641	missense	probably damaging	1.00
R0730:Map1b	UTSW	13	99429766	nonsense	probably null
R1103:Map1b	UTSW	13	99427466	splice site	probably benign
R1300:Map1b	UTSW	13	99432521	missense	unknown
R1353:Map1b	UTSW	13	99427326	missense	unknown
R1387:Map1b	UTSW	13	99432650	missense	unknown
R1481:Map1b	UTSW	13	99431171	missense	unknown
R1509:Map1b	UTSW	13	99431528	missense	unknown
R1521:Map1b	UTSW	13	99432739	missense	unknown
R1604:Map1b	UTSW	13	99429572	missense	unknown
R1649:Map1b	UTSW	13	99516478	missense	probably benign	0.03
R1661:Map1b	UTSW	13	99431929	missense	unknown
R1665:Map1b	UTSW	13	99431929	missense	unknown
R1770:Map1b	UTSW	13	99430493	missense	unknown
R1926:Map1b	UTSW	13	99430692	missense	unknown
R1928:Map1b	UTSW	13	99430946	missense	unknown
R2093:Map1b	UTSW	13	99429670	missense	unknown
R2110:Map1b	UTSW	13	99431121	missense	unknown
R2116:Map1b	UTSW	13	99430644	missense	unknown
R2164:Map1b	UTSW	13	99429338	missense	unknown
R2207:Map1b	UTSW	13	99431083	missense	unknown
R2273:Map1b	UTSW	13	99432084	missense	unknown
R2443:Map1b	UTSW	13	99430411	missense	unknown
R3054:Map1b	UTSW	13	99432742	missense	unknown
R3766:Map1b	UTSW	13	99434087	missense	unknown
R3911:Map1b	UTSW	13	99431072	missense	unknown
R4005:Map1b	UTSW	13	99429907	missense	unknown
R4130:Map1b	UTSW	13	99431680	missense	unknown
R4513:Map1b	UTSW	13	99444233	missense	probably damaging	1.00
R4613:Map1b	UTSW	13	99430302	nonsense	probably null
R4633:Map1b	UTSW	13	99434942	missense	probably damaging	1.00
R4646:Map1b	UTSW	13	99432469	missense	unknown
R4690:Map1b	UTSW	13	99431068	missense	unknown
R4704:Map1b	UTSW	13	99430475	missense	unknown
R4836:Map1b	UTSW	13	99431054	missense	unknown
R4916:Map1b	UTSW	13	99433300	missense	unknown
R4951:Map1b	UTSW	13	99432427	missense	unknown
R4960:Map1b	UTSW	13	99432212	missense	probably benign	0.23
R4961:Map1b	UTSW	13	99435653	missense	probably damaging	1.00
R5030:Map1b	UTSW	13	99434174	missense	unknown
R5090:Map1b	UTSW	13	99430026	nonsense	probably null
R5469:Map1b	UTSW	13	99429338	missense	unknown
R5820:Map1b	UTSW	13	99432824	missense	unknown
R5885:Map1b	UTSW	13	99430081	missense	unknown
R5915:Map1b	UTSW	13	99430331	missense	unknown
R5923:Map1b	UTSW	13	99433153	missense	unknown
R6063:Map1b	UTSW	13	99431137	missense	unknown
R6102:Map1b	UTSW	13	99425873	missense	unknown
R6218:Map1b	UTSW	13	99433206	missense	unknown
R6435:Map1b	UTSW	13	99516363	missense	probably damaging	0.99
R6663:Map1b	UTSW	13	99430022	missense	unknown
R6765:Map1b	UTSW	13	99425941	missense	unknown
R6860:Map1b	UTSW	13	99434767	missense	probably damaging	1.00
R6997:Map1b	UTSW	13	99430634	missense	unknown
R7001:Map1b	UTSW	13	99430593	missense	unknown
R7310:Map1b	UTSW	13	99433655	missense	unknown
R7349:Map1b	UTSW	13	99433640	missense	unknown
R7448:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7449:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7452:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7810:Map1b	UTSW	13	99431882	missense	unknown
R7820:Map1b	UTSW	13	99431177	missense	unknown
R8396:Map1b	UTSW	13	99434113	missense	unknown
R8470:Map1b	UTSW	13	99516442	missense	probably damaging	0.98
R8535:Map1b	UTSW	13	99435154	missense	probably damaging	1.00
R8777:Map1b	UTSW	13	99430796	missense	unknown
R8777-TAIL:Map1b	UTSW	13	99430796	missense	unknown
R8812:Map1b	UTSW	13	99432815	missense	unknown
R8903:Map1b	UTSW	13	99432509	nonsense	probably null
R8928:Map1b	UTSW	13	99432116	missense	unknown
R8954:Map1b	UTSW	13	99434227	missense	unknown
R9164:Map1b	UTSW	13	99425843	missense	unknown
R9164:Map1b	UTSW	13	99432308	nonsense	probably null
R9190:Map1b	UTSW	13	99435406	missense	probably damaging	0.99
R9334:Map1b	UTSW	13	99431640	missense	unknown
R9339:Map1b	UTSW	13	99431062	missense	unknown
R9357:Map1b	UTSW	13	99430200	nonsense	probably null
R9430:Map1b	UTSW	13	99434108	missense	unknown
RF003:Map1b	UTSW	13	99430750	missense	unknown
X0019:Map1b	UTSW	13	99429968	missense	unknown
X0019:Map1b	UTSW	13	99432412	missense	unknown
Z1088:Map1b	UTSW	13	99508115	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- AGAGAAATTCACGCTACGTTCACCC -3'
(R):5'- TGTGATGAGCGACGAGACCAAC -3'

Sequencing Primer
(F):5'- TACGTTCACCCAGGGGAGTC -3'
(R):5'- AGAGTCCCCATCTCAGGAG -3'

Posted On

2014-05-09