Mutagenetix > Incidental Mutations

Incidental Mutation 'R1657:Sphkap'

186434

Institutional Source

Beutler Lab

Gene Symbol

Sphkap

Ensembl Gene

ENSMUSG00000026163

Gene Name

SPHK1 interactor, AKAP domain containing

Synonyms

4930544G21Rik, A930009L15Rik, SKIP

MMRRC Submission

039693-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.084) question?

Stock #

R1657 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

83254139-83408200 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 83277515 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 838 (R838*)

Ref Sequence

ENSEMBL: ENSMUSP00000124872 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159078] [ENSMUST00000160953]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000053075

Predicted Effect

probably null
Transcript: ENSMUST00000159078
AA Change: R551*

SMART Domains

Protein: ENSMUSP00000124384
Gene: ENSMUSG00000026163
AA Change: R551*

Domain	Start	End	E-Value	Type
low complexity region	303	314	N/A	INTRINSIC
SCOP:d1ash__	382	462	5e-3	SMART
low complexity region	809	819	N/A	INTRINSIC
low complexity region	854	865	N/A	INTRINSIC
low complexity region	1202	1221	N/A	INTRINSIC
low complexity region	1243	1254	N/A	INTRINSIC
Pfam:AKAP_110	1281	1398	7.5e-13	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000160953
AA Change: R838*

SMART Domains

Protein: ENSMUSP00000124872
Gene: ENSMUSG00000026163
AA Change: R838*

Domain	Start	End	E-Value	Type
low complexity region	590	601	N/A	INTRINSIC
SCOP:d1ash__	669	749	6e-3	SMART
low complexity region	1096	1106	N/A	INTRINSIC
low complexity region	1141	1152	N/A	INTRINSIC
low complexity region	1489	1508	N/A	INTRINSIC
Pfam:AKAP_110	1540	1655	6.4e-12	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009B22Rik	T	C	11: 51,685,678	Q131R	probably benign	Het
3632451O06Rik	G	C	14: 49,773,560	T230S	probably damaging	Het
Acaca	T	G	11: 84,264,084	D988E	probably benign	Het
Als2	A	G	1: 59,180,601	V1185A	probably damaging	Het
Amdhd2	A	G	17: 24,156,055	V391A	probably damaging	Het
Caprin1	A	T	2: 103,769,506	V608E	probably damaging	Het
Celsr3	T	A	9: 108,842,952	C2512*	probably null	Het
Cfl1	A	T	19: 5,493,555	R187W	probably damaging	Het
Cgnl1	C	T	9: 71,725,944	V42I	probably damaging	Het
Chd2	A	G	7: 73,480,430	Y826H	probably damaging	Het
Col9a2	C	A	4: 121,040,974	P28T	unknown	Het
Cyp3a44	G	A	5: 145,779,743	P346S	probably damaging	Het
Dact2	A	G	17: 14,197,990	V151A	probably benign	Het
Dhx29	T	C	13: 112,952,843	I716T	probably damaging	Het
Esam	T	C	9: 37,537,621	S342P	probably damaging	Het
Fam189a2	C	A	19: 23,975,635	C437F	probably damaging	Het
Fer1l4	A	G	2: 156,035,598	V1053A	possibly damaging	Het
Grk3	A	G	5: 112,966,982	F124S	probably damaging	Het
H2-DMa	G	A	17: 34,137,399		probably null	Het
Hsd3b5	T	A	3: 98,619,720	I137F	possibly damaging	Het
Itgav	A	T	2: 83,801,779	I902F	probably benign	Het
Itsn1	G	T	16: 91,909,223	C179F	probably damaging	Het
Kcnh8	G	A	17: 52,839,125	R347H	probably damaging	Het
Kif9	T	C	9: 110,489,966	M166T	possibly damaging	Het
Kmt5c	C	T	7: 4,746,454	Q324*	probably null	Het
Lcn9	G	A	2: 25,824,710	E154K	probably benign	Het
Mfge8	A	T	7: 79,141,773	L227Q	probably benign	Het
Mroh2b	A	T	15: 4,931,043	R753*	probably null	Het
Mtif2	G	A	11: 29,540,721	R475Q	probably benign	Het
Nln	C	T	13: 104,036,947	V584I	possibly damaging	Het
Nr2e3	T	C	9: 59,948,767	E129G	probably benign	Het
Ocstamp	T	C	2: 165,397,516	D250G	probably damaging	Het
Olfr1065	A	C	2: 86,445,218	L255V	probably damaging	Het
Olfr403	A	T	11: 74,195,896	H131L	probably damaging	Het
Olfr503	T	C	7: 108,545,377	I284T	possibly damaging	Het
Pld1	A	T	3: 28,071,187	I417L	probably benign	Het
Polr1a	A	T	6: 71,941,535	K692N	probably damaging	Het
Qsox2	A	T	2: 26,220,747	Y152*	probably null	Het
Rpap1	T	C	2: 119,783,778	D46G	possibly damaging	Het
Rpe65	A	G	3: 159,614,448	T246A	probably damaging	Het
Scn5a	T	C	9: 119,562,380	D82G	probably damaging	Het
Sema3d	A	G	5: 12,584,974	E669G	possibly damaging	Het
Serpinb6c	T	C	13: 33,880,226	N282S	probably benign	Het
Snap47	A	T	11: 59,428,770	S181T	probably benign	Het
Snx9	A	C	17: 5,918,436	T336P	possibly damaging	Het
Terb1	A	T	8: 104,488,491	D284E	possibly damaging	Het
Tmem266	C	T	9: 55,418,008	A153V	probably damaging	Het
Ttn	T	C	2: 76,742,804	E25915G	possibly damaging	Het
Tubal3	A	G	13: 3,933,011	T264A	possibly damaging	Het
Vldlr	G	A	19: 27,245,670	R747Q	probably benign	Het
Zc3h8	G	T	2: 128,929,957		probably benign	Het
Zfp184	C	T	13: 21,959,273	T383M	probably damaging	Het
Zfp455	T	C	13: 67,198,639	F38S	possibly damaging	Het
Zfp746	A	G	6: 48,082,174	V167A	possibly damaging	Het
Zfp985	T	A	4: 147,584,110	N478K	probably benign	Het

Other mutations in Sphkap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Sphkap	APN	1	83280516	missense	probably damaging	1.00
IGL00337:Sphkap	APN	1	83339608	missense	probably damaging	1.00
IGL00470:Sphkap	APN	1	83277910	missense	possibly damaging	0.87
IGL00577:Sphkap	APN	1	83278844	missense	probably damaging	1.00
IGL00657:Sphkap	APN	1	83276375	missense	probably damaging	1.00
IGL01868:Sphkap	APN	1	83280399	splice site	probably null
IGL02101:Sphkap	APN	1	83290987	missense	probably damaging	1.00
IGL02471:Sphkap	APN	1	83276176	missense	probably damaging	1.00
IGL02943:Sphkap	APN	1	83276831	missense	probably damaging	1.00
IGL02945:Sphkap	APN	1	83276831	missense	probably damaging	1.00
IGL03008:Sphkap	APN	1	83276831	missense	probably damaging	1.00
IGL03031:Sphkap	APN	1	83276831	missense	probably damaging	1.00
IGL03059:Sphkap	APN	1	83257242	missense	probably damaging	0.97
IGL03085:Sphkap	APN	1	83280354	missense	possibly damaging	0.92
IGL03355:Sphkap	APN	1	83280503	missense	probably damaging	1.00
IGL03356:Sphkap	APN	1	83276831	missense	probably damaging	1.00
IGL03368:Sphkap	APN	1	83275676	missense	probably benign	0.14
R0294:Sphkap	UTSW	1	83278245	missense	possibly damaging	0.72
R0308:Sphkap	UTSW	1	83276969	missense	probably damaging	1.00
R0478:Sphkap	UTSW	1	83278711	missense	probably damaging	1.00
R0606:Sphkap	UTSW	1	83280424	missense	probably damaging	1.00
R0678:Sphkap	UTSW	1	83278628	missense	probably benign	0.03
R1216:Sphkap	UTSW	1	83290977	missense	probably damaging	1.00
R1253:Sphkap	UTSW	1	83278898	missense	possibly damaging	0.56
R1532:Sphkap	UTSW	1	83257203	missense	probably damaging	1.00
R1635:Sphkap	UTSW	1	83278400	missense	probably benign	0.03
R1655:Sphkap	UTSW	1	83277515	nonsense	probably null
R1700:Sphkap	UTSW	1	83277515	nonsense	probably null
R1701:Sphkap	UTSW	1	83277515	nonsense	probably null
R1734:Sphkap	UTSW	1	83277515	nonsense	probably null
R1736:Sphkap	UTSW	1	83277515	nonsense	probably null
R1743:Sphkap	UTSW	1	83277515	nonsense	probably null
R1744:Sphkap	UTSW	1	83277515	nonsense	probably null
R1760:Sphkap	UTSW	1	83277544	missense	probably benign	0.29
R1893:Sphkap	UTSW	1	83278966	missense	probably benign	0.02
R1937:Sphkap	UTSW	1	83267441	nonsense	probably null
R1986:Sphkap	UTSW	1	83277922	missense	probably damaging	1.00
R1993:Sphkap	UTSW	1	83277515	nonsense	probably null
R1995:Sphkap	UTSW	1	83277515	nonsense	probably null
R2001:Sphkap	UTSW	1	83276662	missense	probably damaging	1.00
R2004:Sphkap	UTSW	1	83277911	missense	probably benign	0.04
R2111:Sphkap	UTSW	1	83275881	missense	probably benign	0.00
R2112:Sphkap	UTSW	1	83275881	missense	probably benign	0.00
R2156:Sphkap	UTSW	1	83277989	missense	probably benign	0.03
R2182:Sphkap	UTSW	1	83276684	missense	probably damaging	1.00
R2271:Sphkap	UTSW	1	83257221	missense	probably damaging	1.00
R3712:Sphkap	UTSW	1	83277112	missense	probably benign	0.27
R3919:Sphkap	UTSW	1	83276458	missense	probably damaging	1.00
R3980:Sphkap	UTSW	1	83267494	splice site	probably null
R4130:Sphkap	UTSW	1	83277898	missense	probably damaging	0.96
R4539:Sphkap	UTSW	1	83277793	missense	probably benign	0.00
R4602:Sphkap	UTSW	1	83279061	nonsense	probably null
R4735:Sphkap	UTSW	1	83279117	missense	probably benign	0.01
R4793:Sphkap	UTSW	1	83278084	missense	possibly damaging	0.77
R4849:Sphkap	UTSW	1	83277384	missense	probably benign	0.03
R4880:Sphkap	UTSW	1	83288817	missense	probably damaging	1.00
R5213:Sphkap	UTSW	1	83280503	missense	probably damaging	1.00
R5277:Sphkap	UTSW	1	83276164	missense	probably benign	0.04
R5331:Sphkap	UTSW	1	83276782	missense	probably benign	0.08
R5632:Sphkap	UTSW	1	83278285	missense	probably benign	0.01
R5647:Sphkap	UTSW	1	83407999	missense	probably damaging	0.98
R5751:Sphkap	UTSW	1	83275897	missense	probably benign	0.27
R5935:Sphkap	UTSW	1	83339599	missense	probably damaging	1.00
R5999:Sphkap	UTSW	1	83267405	missense	probably benign	0.02
R6232:Sphkap	UTSW	1	83280479	missense	probably damaging	1.00
R6318:Sphkap	UTSW	1	83278378	missense	probably damaging	1.00
R6474:Sphkap	UTSW	1	83278823	missense	probably damaging	1.00
R6602:Sphkap	UTSW	1	83275758	missense	possibly damaging	0.75
R6674:Sphkap	UTSW	1	83277834	missense	probably benign	0.37
R6716:Sphkap	UTSW	1	83362228	critical splice donor site	probably null
R6803:Sphkap	UTSW	1	83280510	missense	probably damaging	1.00
R6880:Sphkap	UTSW	1	83257257	missense	probably damaging	1.00
R6941:Sphkap	UTSW	1	83408090	start gained	probably benign
R7170:Sphkap	UTSW	1	83265985	missense	probably damaging	0.99
R7263:Sphkap	UTSW	1	83276678	missense	probably damaging	1.00
R7422:Sphkap	UTSW	1	83263826	missense	probably benign	0.02
R7640:Sphkap	UTSW	1	83278928	missense	possibly damaging	0.94
R7722:Sphkap	UTSW	1	83278921	missense	probably benign	0.00
R7810:Sphkap	UTSW	1	83276300	missense	probably damaging	1.00
R7887:Sphkap	UTSW	1	83277412	missense	probably benign	0.00
R7974:Sphkap	UTSW	1	83278962	missense	probably damaging	1.00
R7990:Sphkap	UTSW	1	83267345	missense	probably damaging	0.99
R8096:Sphkap	UTSW	1	83277558	missense	probably damaging	0.98
R8110:Sphkap	UTSW	1	83278771	missense	possibly damaging	0.82
R8125:Sphkap	UTSW	1	83263582	missense	probably damaging	1.00
R8153:Sphkap	UTSW	1	83278009	missense	possibly damaging	0.93
R8245:Sphkap	UTSW	1	83278771	missense	probably benign	0.14
R8394:Sphkap	UTSW	1	83276076	missense	probably benign	0.08
R8443:Sphkap	UTSW	1	83278232	missense	probably benign	0.00
R8508:Sphkap	UTSW	1	83276500	missense	probably damaging	1.00
R8531:Sphkap	UTSW	1	83277188	missense	probably damaging	1.00
Z1088:Sphkap	UTSW	1	83276608	missense	probably damaging	1.00
Z1088:Sphkap	UTSW	1	83278604	missense	probably damaging	1.00
Z1176:Sphkap	UTSW	1	83276033	nonsense	probably null
Z1176:Sphkap	UTSW	1	83280442	missense	possibly damaging	0.61
Z1177:Sphkap	UTSW	1	83276431	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- ATAGACCTCGGACTGCTTTGCCTC -3'
(R):5'- AGCCAGCCTCTTAGCAATGCAC -3'

Sequencing Primer
(F):5'- TCTAGAGTAGACTGAGCAGGAAC -3'
(R):5'- ACTGGCCTTGTCATCAGGAATC -3'

Posted On

2014-05-09