Mutagenetix > Incidental Mutations

Incidental Mutation 'R1657:Lcn9'

186435

Institutional Source

Beutler Lab

Gene Symbol

Lcn9

Ensembl Gene

ENSMUSG00000023210

Gene Name

lipocalin 9

Synonyms

MMRRC Submission

039693-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.054) question?

Stock #

R1657 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

25823153-25825537 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 25824710 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 154 (E154K)

Ref Sequence

ENSEMBL: ENSMUSP00000023978 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023978]

Predicted Effect

probably benign
Transcript: ENSMUST00000023978
AA Change: E154K

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000023978
Gene: ENSMUSG00000023210
AA Change: E154K

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Pfam:Lipocalin	34	174	6e-37	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the lipocalin family, such as LCN9, have a common structure consisting of an 8-stranded antiparallel beta-barrel that forms a cup-shaped ligand-binding pocket or calyx. Lipocalins generally bind small hydrophobic ligands and transport them to specific cells (Suzuki et al., 2004 [PubMed 15363845]).[supplied by OMIM, Aug 2009]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009B22Rik	T	C	11: 51,685,678	Q131R	probably benign	Het
3632451O06Rik	G	C	14: 49,773,560	T230S	probably damaging	Het
Acaca	T	G	11: 84,264,084	D988E	probably benign	Het
Als2	A	G	1: 59,180,601	V1185A	probably damaging	Het
Amdhd2	A	G	17: 24,156,055	V391A	probably damaging	Het
Caprin1	A	T	2: 103,769,506	V608E	probably damaging	Het
Celsr3	T	A	9: 108,842,952	C2512*	probably null	Het
Cfl1	A	T	19: 5,493,555	R187W	probably damaging	Het
Cgnl1	C	T	9: 71,725,944	V42I	probably damaging	Het
Chd2	A	G	7: 73,480,430	Y826H	probably damaging	Het
Col9a2	C	A	4: 121,040,974	P28T	unknown	Het
Cyp3a44	G	A	5: 145,779,743	P346S	probably damaging	Het
Dact2	A	G	17: 14,197,990	V151A	probably benign	Het
Dhx29	T	C	13: 112,952,843	I716T	probably damaging	Het
Esam	T	C	9: 37,537,621	S342P	probably damaging	Het
Fam189a2	C	A	19: 23,975,635	C437F	probably damaging	Het
Fer1l4	A	G	2: 156,035,598	V1053A	possibly damaging	Het
Grk3	A	G	5: 112,966,982	F124S	probably damaging	Het
H2-DMa	G	A	17: 34,137,399		probably null	Het
Hsd3b5	T	A	3: 98,619,720	I137F	possibly damaging	Het
Itgav	A	T	2: 83,801,779	I902F	probably benign	Het
Itsn1	G	T	16: 91,909,223	C179F	probably damaging	Het
Kcnh8	G	A	17: 52,839,125	R347H	probably damaging	Het
Kif9	T	C	9: 110,489,966	M166T	possibly damaging	Het
Kmt5c	C	T	7: 4,746,454	Q324*	probably null	Het
Mfge8	A	T	7: 79,141,773	L227Q	probably benign	Het
Mroh2b	A	T	15: 4,931,043	R753*	probably null	Het
Mtif2	G	A	11: 29,540,721	R475Q	probably benign	Het
Nln	C	T	13: 104,036,947	V584I	possibly damaging	Het
Nr2e3	T	C	9: 59,948,767	E129G	probably benign	Het
Ocstamp	T	C	2: 165,397,516	D250G	probably damaging	Het
Olfr1065	A	C	2: 86,445,218	L255V	probably damaging	Het
Olfr403	A	T	11: 74,195,896	H131L	probably damaging	Het
Olfr503	T	C	7: 108,545,377	I284T	possibly damaging	Het
Pld1	A	T	3: 28,071,187	I417L	probably benign	Het
Polr1a	A	T	6: 71,941,535	K692N	probably damaging	Het
Qsox2	A	T	2: 26,220,747	Y152*	probably null	Het
Rpap1	T	C	2: 119,783,778	D46G	possibly damaging	Het
Rpe65	A	G	3: 159,614,448	T246A	probably damaging	Het
Scn5a	T	C	9: 119,562,380	D82G	probably damaging	Het
Sema3d	A	G	5: 12,584,974	E669G	possibly damaging	Het
Serpinb6c	T	C	13: 33,880,226	N282S	probably benign	Het
Snap47	A	T	11: 59,428,770	S181T	probably benign	Het
Snx9	A	C	17: 5,918,436	T336P	possibly damaging	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Terb1	A	T	8: 104,488,491	D284E	possibly damaging	Het
Tmem266	C	T	9: 55,418,008	A153V	probably damaging	Het
Ttn	T	C	2: 76,742,804	E25915G	possibly damaging	Het
Tubal3	A	G	13: 3,933,011	T264A	possibly damaging	Het
Vldlr	G	A	19: 27,245,670	R747Q	probably benign	Het
Zc3h8	G	T	2: 128,929,957		probably benign	Het
Zfp184	C	T	13: 21,959,273	T383M	probably damaging	Het
Zfp455	T	C	13: 67,198,639	F38S	possibly damaging	Het
Zfp746	A	G	6: 48,082,174	V167A	possibly damaging	Het
Zfp985	T	A	4: 147,584,110	N478K	probably benign	Het

Other mutations in Lcn9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01952:Lcn9	APN	2	25824538	missense	probably damaging	1.00
IGL02417:Lcn9	APN	2	25823680	missense	possibly damaging	0.91
PIT4418001:Lcn9	UTSW	2	25824541	missense	probably damaging	1.00
R1479:Lcn9	UTSW	2	25823703	splice site	probably benign
R4199:Lcn9	UTSW	2	25824761	missense	probably benign	0.15
R4526:Lcn9	UTSW	2	25824508	missense	possibly damaging	0.85
R4570:Lcn9	UTSW	2	25823579	missense	probably benign	0.04
R5232:Lcn9	UTSW	2	25824055	critical splice donor site	probably null
R5577:Lcn9	UTSW	2	25823651	missense	probably damaging	1.00
R5849:Lcn9	UTSW	2	25823256	critical splice donor site	probably null
R6059:Lcn9	UTSW	2	25824725	missense	possibly damaging	0.62
R7748:Lcn9	UTSW	2	25824914	makesense	probably null

Predicted Primers

PCR Primer
(F):5'- AACAAGGTGCTGCTCTTGGAGAC -3'
(R):5'- TGTCAGATGGCTTGCTCAACCC -3'

Sequencing Primer
(F):5'- TGCTCTTGGAGACCGACTAC -3'
(R):5'- GCTCAACCCCTGTCCCAG -3'

Posted On

2014-05-09