Incidental Mutation 'R1657:Or8k27'
ID 186441
Institutional Source Beutler Lab
Gene Symbol Or8k27
Ensembl Gene ENSMUSG00000111306
Gene Name olfactory receptor family 8 subfamily K member 27
Synonyms Olfr1065, GA_x6K02T2Q125-47915274-47914333, MOR190-1
MMRRC Submission 039693-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.159) question?
Stock # R1657 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 86275357-86276348 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 86275562 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Valine at position 255 (L255V)
Ref Sequence ENSEMBL: ENSMUSP00000149248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000213789] [ENSMUST00000216162] [ENSMUST00000216165] [ENSMUST00000217586]
AlphaFold Q7TR70
Predicted Effect probably damaging
Transcript: ENSMUST00000099886
AA Change: L255V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097471
Gene: ENSMUSG00000075182
AA Change: L255V

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.1e-53 PFAM
Pfam:7tm_1 41 290 1.2e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213789
AA Change: L255V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000216162
AA Change: L255V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000216165
AA Change: L255V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000217586
AA Change: L255V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T G 11: 84,154,910 (GRCm39) D988E probably benign Het
Als2 A G 1: 59,219,760 (GRCm39) V1185A probably damaging Het
Amdhd2 A G 17: 24,375,029 (GRCm39) V391A probably damaging Het
Armh4 G C 14: 50,011,017 (GRCm39) T230S probably damaging Het
Caprin1 A T 2: 103,599,851 (GRCm39) V608E probably damaging Het
Celsr3 T A 9: 108,720,151 (GRCm39) C2512* probably null Het
Cfl1 A T 19: 5,543,583 (GRCm39) R187W probably damaging Het
Cgnl1 C T 9: 71,633,226 (GRCm39) V42I probably damaging Het
Chd2 A G 7: 73,130,178 (GRCm39) Y826H probably damaging Het
Col9a2 C A 4: 120,898,171 (GRCm39) P28T unknown Het
Cyp3a44 G A 5: 145,716,553 (GRCm39) P346S probably damaging Het
Dact2 A G 17: 14,418,252 (GRCm39) V151A probably benign Het
Dhx29 T C 13: 113,089,377 (GRCm39) I716T probably damaging Het
Entrep1 C A 19: 23,952,999 (GRCm39) C437F probably damaging Het
Esam T C 9: 37,448,917 (GRCm39) S342P probably damaging Het
Fer1l4 A G 2: 155,877,518 (GRCm39) V1053A possibly damaging Het
Grk3 A G 5: 113,114,848 (GRCm39) F124S probably damaging Het
H2-DMa G A 17: 34,356,373 (GRCm39) probably null Het
Hsd3b5 T A 3: 98,527,036 (GRCm39) I137F possibly damaging Het
Itgav A T 2: 83,632,123 (GRCm39) I902F probably benign Het
Itsn1 G T 16: 91,706,111 (GRCm39) C179F probably damaging Het
Kcnh8 G A 17: 53,146,153 (GRCm39) R347H probably damaging Het
Kif9 T C 9: 110,319,034 (GRCm39) M166T possibly damaging Het
Kmt5c C T 7: 4,749,453 (GRCm39) Q324* probably null Het
Lcn9 G A 2: 25,714,722 (GRCm39) E154K probably benign Het
Mfge8 A T 7: 78,791,521 (GRCm39) L227Q probably benign Het
Mroh2b A T 15: 4,960,525 (GRCm39) R753* probably null Het
Mtif2 G A 11: 29,490,721 (GRCm39) R475Q probably benign Het
Nln C T 13: 104,173,455 (GRCm39) V584I possibly damaging Het
Nr2e3 T C 9: 59,856,050 (GRCm39) E129G probably benign Het
Ocstamp T C 2: 165,239,436 (GRCm39) D250G probably damaging Het
Or1a1 A T 11: 74,086,722 (GRCm39) H131L probably damaging Het
Or52n4b T C 7: 108,144,584 (GRCm39) I284T possibly damaging Het
Pld1 A T 3: 28,125,336 (GRCm39) I417L probably benign Het
Polr1a A T 6: 71,918,519 (GRCm39) K692N probably damaging Het
Qsox2 A T 2: 26,110,759 (GRCm39) Y152* probably null Het
Rpap1 T C 2: 119,614,259 (GRCm39) D46G possibly damaging Het
Rpe65 A G 3: 159,320,085 (GRCm39) T246A probably damaging Het
Scn5a T C 9: 119,391,446 (GRCm39) D82G probably damaging Het
Sema3d A G 5: 12,634,941 (GRCm39) E669G possibly damaging Het
Serpinb6c T C 13: 34,064,209 (GRCm39) N282S probably benign Het
Snap47 A T 11: 59,319,596 (GRCm39) S181T probably benign Het
Snx9 A C 17: 5,968,711 (GRCm39) T336P possibly damaging Het
Sphkap G A 1: 83,255,236 (GRCm39) R838* probably null Het
Terb1 A T 8: 105,215,123 (GRCm39) D284E possibly damaging Het
Tmem266 C T 9: 55,325,292 (GRCm39) A153V probably damaging Het
Trappc2b T C 11: 51,576,505 (GRCm39) Q131R probably benign Het
Ttn T C 2: 76,573,148 (GRCm39) E25915G possibly damaging Het
Tubal3 A G 13: 3,983,011 (GRCm39) T264A possibly damaging Het
Vldlr G A 19: 27,223,070 (GRCm39) R747Q probably benign Het
Zc3h8 G T 2: 128,771,877 (GRCm39) probably benign Het
Zfp184 C T 13: 22,143,443 (GRCm39) T383M probably damaging Het
Zfp455 T C 13: 67,346,703 (GRCm39) F38S possibly damaging Het
Zfp746 A G 6: 48,059,108 (GRCm39) V167A possibly damaging Het
Zfp985 T A 4: 147,668,567 (GRCm39) N478K probably benign Het
Other mutations in Or8k27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03133:Or8k27 APN 2 86,276,002 (GRCm39) missense probably damaging 0.99
IGL03173:Or8k27 APN 2 86,275,788 (GRCm39) nonsense probably null
IGL03257:Or8k27 APN 2 86,276,234 (GRCm39) missense probably damaging 0.98
D4043:Or8k27 UTSW 2 86,275,564 (GRCm39) missense probably damaging 0.99
R0265:Or8k27 UTSW 2 86,276,303 (GRCm39) missense probably benign 0.00
R0550:Or8k27 UTSW 2 86,276,220 (GRCm39) nonsense probably null
R0633:Or8k27 UTSW 2 86,275,473 (GRCm39) missense probably benign 0.45
R0727:Or8k27 UTSW 2 86,276,282 (GRCm39) missense probably benign 0.00
R1017:Or8k27 UTSW 2 86,275,772 (GRCm39) missense probably benign 0.13
R1416:Or8k27 UTSW 2 86,275,664 (GRCm39) missense probably benign 0.43
R1983:Or8k27 UTSW 2 86,275,420 (GRCm39) missense probably benign 0.01
R3919:Or8k27 UTSW 2 86,275,762 (GRCm39) missense probably benign 0.01
R4345:Or8k27 UTSW 2 86,276,189 (GRCm39) missense probably damaging 1.00
R5382:Or8k27 UTSW 2 86,275,660 (GRCm39) missense probably damaging 0.99
R5757:Or8k27 UTSW 2 86,275,922 (GRCm39) missense probably benign 0.22
R6530:Or8k27 UTSW 2 86,275,826 (GRCm39) missense probably benign 0.31
R6765:Or8k27 UTSW 2 86,275,580 (GRCm39) missense probably benign 0.04
R6856:Or8k27 UTSW 2 86,276,251 (GRCm39) missense probably benign 0.04
R7156:Or8k27 UTSW 2 86,275,652 (GRCm39) missense probably damaging 1.00
R8239:Or8k27 UTSW 2 86,275,473 (GRCm39) missense noncoding transcript
R8338:Or8k27 UTSW 2 86,275,729 (GRCm39) missense probably benign 0.00
R8909:Or8k27 UTSW 2 86,276,082 (GRCm39) missense possibly damaging 0.80
R9469:Or8k27 UTSW 2 86,275,787 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTGTGGATTTCAAAAGCAAACACT -3'
(R):5'- TCAACAACTGTGGGACCCAAAATGTTA -3'

Sequencing Primer
(F):5'- CTGTGTAGTTTTTTCCCTGTCC -3'
(R):5'- GCAATGTCCTATGACCGCTATG -3'
Posted On 2014-05-09